콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU065431

Sigma-Aldrich

MISSION® esiRNA

targeting human KEAP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACA

Ensembl | 인체 수납 번호

ENSG00000079999

NCBI 수납 번호

NM_012289

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KEAP1(9817) , KEAP1(9817)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Min-Kyun Song et al.
Free radical biology & medicine, 138, 33-42 (2019-05-07)
Transforming growth factor-β (TGF-β) is a potent pathogenic factor of renal injury through the upregulation of extracellular matrix (ECM) expression and facilitation of renal fibrosis. Nuclear factor erythroid 2-like 2 (Nfe2l2; Nrf2), a master regulator of antioxidant and detoxifying systems
Jinqian Liang et al.
Cell death & disease, 10(12), 888-888 (2019-11-27)
Activation of nuclear-factor-E2-related factor 2 (Nrf2) cascade can alleviate dexamethasone (DEX)-induced oxidative injury and death of human osteoblasts. A recent study has shown that phosphoglycerate kinase 1 (PGK1) inhibition/depletion will lead to Kelch-like ECH-associated protein 1 (Keap1) methylglyoxal modification, thereby
Min Cai et al.
Anesthesiology, 126(3), 507-521 (2017-01-04)
The authors have reported that antioxidative effects play a crucial role in the volatile anesthetic-induced neuroprotection. Accumulated evidence shows that endogenous antioxidation could be up-regulated by nuclear factor-E2-related factor 2 through multiple pathways. However, whether nuclear factor-E2-related factor 2 activation
Indira D Pokkunuri et al.
American journal of physiology. Renal physiology, 319(4), F686-F696 (2020-08-25)
Renal proximal tubular apoptosis plays a critical role in kidney health and disease. However, cellular molecules that trigger renal apoptosis remain elusive. Here, we evaluated the effect of inhibiting protein disulfide isomerase (PDI), a critical thioredoxin chaperone protein, on apoptosis
Weixia Sun et al.
Free radical biology & medicine, 108, 840-857 (2017-05-02)
Epigallocatechin gallate (EGCG) is the most abundant and effective green tea catechin and has been reported to attenuate diabetic nephropathy (DN). However, the mechanism by which EGCG ameliorates DN, till now, has remained unclear. EGCG is known as a potent
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.