추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTCAAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTGCTGGACAAGTGTCAAGAGGTCATCTCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAGGAGGTAGATTAGGGGCCTTTCCAAGATTGCTGTTTTTGTTTTGGAGCTTCAAGACTTTGCATTTCCTAGTATTTCTGTTTGTCAGTTCTCAATTTCCTGTGTTTGCAATGTTGAAATTTTTTGGTGAAGTACTGAACTTGCTTTTTTTCCGGTTTCTACATGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HSPA1A(3303) , HSPA1A(3303)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ilse M Beck et al.
PloS one, 8(7), e69115-e69115 (2013-08-13)
Compound A possesses glucocorticoid receptor (GR)-dependent anti-inflammatory properties. Just like classical GR ligands, Compound A can repress NF-κB-mediated gene expression. However, the monomeric Compound A-activated GR is unable to trigger glucocorticoid response element-regulated gene expression. The heat shock response potently
Chungen Yan et al.
International journal of clinical and experimental medicine, 8(4), 5746-5752 (2015-07-02)
To explore the ultrasound-guided gene transfection as well as the role of heat shock protein 72 (HSP72) siRNA combined with ultrasound micro-bubble contrast agents on rat hepatic ischemia-reperfusion injury. 72 SD rats were divided into non-surgery group (group N), sham-operation
Taek-Keun Kim et al.
Biochemical and biophysical research communications, 469(2), 222-228 (2015-12-15)
Heat shock protein 70-1A (HSP70-1A) is a stress-inducible protein that provides an essential intracellular molecular chaperone function; however, the mechanism of HSP70-1A in angiogenesis has not been clarified. Herein, HSP70-1A gene silencing implicated this protein in angiogenesis. Additionally, recombinant human
Pterostilbene-induced tumor cytotoxicity: a lysosomal membrane permeabilization-dependent mechanism.
Salvador Mena et al.
PloS one, 7(9), e44524-e44524 (2012-09-08)
The phenolic phytoalexin resveratrol is well known for its health-promoting and anticancer properties. Its potential benefits are, however, limited due to its low bioavailability. Pterostilbene, a natural dimethoxylated analog of resveratrol, presents higher anticancer activity than resveratrol. The mechanisms by
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.