콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU107721

Sigma-Aldrich

MISSION® esiRNA

targeting human HSF1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATTCCCTCCTTGCTCGAGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCTGACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACCGACGCGCTCATCTGCTGGAGCCCGAGCGGGAACAGCTTCCACGTGTTCGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAACAACATGGCCAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGGAAAGTGGTCCACATCGAGCAGGGCGGCCTGGTCAAGCCAGAGAGAGACGACACGGAGTTCCAGCACCCATGCTTCCTGCGTGGCCAGGAGCAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGTGTGTCCACCCTGAAGAGTGAAGACATAAAGATCCGCCAGGA

Ensembl | 인체 수납 번호

ENSG00000185122

NCBI 수납 번호

NM_005526

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HSF1(3297) , HSF1(3297)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Seok Jun Kim et al.
Yonsei medical journal, 59(9), 1041-1048 (2018-10-18)
Heat shock factor 1 (HSF1) is a key regulator of the heat shock response and plays an important role in various cancers. However, the role of HSF1 in gastric cancer is still unknown. The present study evaluated the function of
Liang Chen et al.
Cell cycle (Georgetown, Tex.), 18(1), 60-68 (2018-12-20)
Cells mainly rely on stress proteins, such as heat-shock proteins (HSPs), to respond to various proteotoxic conditions. These proteins protect tumor cells and enhance their survive. However, the regulation of stress proteins involved in protein quality control (PQC) is still
Antonio Cigliano et al.
Oncotarget, 8(33), 54149-54159 (2017-09-15)
Upregulation of the heat shock transcription factor 1 (HSF1) has been described as a frequent event in many cancer types, but its oncogenic role in hepatocellular carcinoma (HCC) remains poorly delineated. In the present study, we assessed the function(s) of
Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Jacqueline H L Fok et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(10), 2395-2407 (2018-02-03)
Purpose: Myeloma is a plasma cell malignancy characterized by the overproduction of immunoglobulin, and is therefore susceptible to therapies targeting protein homeostasis. We hypothesized that heat shock factor 1 (HSF1) was an attractive therapeutic target for myeloma due to its
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.