콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU022531

Sigma-Aldrich

MISSION® esiRNA

targeting human ULK1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAGAACCTCGCCAAGTCTCAGACGCTGCTGGGGAAGGAAATCAAAATCCTGAAGGAACTGAAACATGAAAACATCGTGGCCCTGTACGACTTCCAGGAAATGGCTAATTCTGTCTACCTGGTTATGGAGTACTGCAACGGTGGGGACCTGGCCGACTACCTGCACGCCATGCGCACGCTGAGCGAGGACACCATCAGGCTCTTCCTGCAGCAGATCGCGGGCGCCATGCGGCTTCTGCACAGCAAAGGCATCATCCACCGCGACCTGAAACCGCAGAACATCCTGCTGTCCAACCCCGCCGGCCGCCGCGCCAACCCCAACAGCATCCGCGTCAAGATCGCTGACTTCGGCTTCGCGCGGTACCTCCAGAGCAACATGATGGCGGCCACACTCTGCGGCTCCCCCATGTACATGGCCCCCGAGGTCATCATGTCCCAGCACTACGACGGGAAGGCGGACCTGTGGAGCATCGGCACCATCGTCTACCAGTGCCTGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shan Zhu et al.
Autophagy, 9(3), 317-327 (2012-12-18)
IFN1@ (interferon, type 1, cluster, also called IFNα) has been extensively studied as a treatment for patients with chronic myeloid leukemia (CML). The mechanism of anticancer activity of IFN1@ is complex and not well understood. Here, we demonstrate that autophagy
Tiejian Nie et al.
Cell death & disease, 7(12), e2563-e2563 (2016-12-30)
Endoplasmic reticulum (ER) stress is involved in many cellular processes. Emerging evidence suggests that ER stress can trigger autophagy; however, the mechanisms by which ER stress regulates autophagy and its role in this condition are not fully understood. HIV Tat-interactive
Min Liu et al.
Toxicology letters, 283, 106-115 (2017-11-13)
Mitochondrial aldehyde dehydrogenase 2 (ALDH2), an important enzyme in the elimination of toxic aldehydes, is involved in cardioprotection against diabetes mellitus. This study was designed to examine the mechanism behind ALDH2-offered protection against high glucose exposure with a focus on
Yalitza Lopez Corcino et al.
Scientific reports, 9(1), 669-669 (2019-01-27)
Little is known about strategies used by pathogens to facilitate CNS invasion. Toxoplasma gondii reaches the CNS by circulating in blood within leukocytes or as extracellular tachyzoites. T. gondii induces EGFR signaling in vitro during invasion of mammalian cells. We
Arup Sarkar et al.
The Journal of infectious diseases, 216(12), 1655-1666 (2017-10-14)
Macrophages are specialized phagocytic cells involved in clearing invading pathogens. Previously we reported that engulfment and cell motility protein 1 (ELMO1) in macrophages mediates bacterial internalization and intestinal inflammation. Here we studied the role of ELMO1 in the fate of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.