추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAGAACCTCGCCAAGTCTCAGACGCTGCTGGGGAAGGAAATCAAAATCCTGAAGGAACTGAAACATGAAAACATCGTGGCCCTGTACGACTTCCAGGAAATGGCTAATTCTGTCTACCTGGTTATGGAGTACTGCAACGGTGGGGACCTGGCCGACTACCTGCACGCCATGCGCACGCTGAGCGAGGACACCATCAGGCTCTTCCTGCAGCAGATCGCGGGCGCCATGCGGCTTCTGCACAGCAAAGGCATCATCCACCGCGACCTGAAACCGCAGAACATCCTGCTGTCCAACCCCGCCGGCCGCCGCGCCAACCCCAACAGCATCCGCGTCAAGATCGCTGACTTCGGCTTCGCGCGGTACCTCCAGAGCAACATGATGGCGGCCACACTCTGCGGCTCCCCCATGTACATGGCCCCCGAGGTCATCATGTCCCAGCACTACGACGGGAAGGCGGACCTGTGGAGCATCGGCACCATCGTCTACCAGTGCCTGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ULK1(8408) , ULK1(8408)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Shan Zhu et al.
Autophagy, 9(3), 317-327 (2012-12-18)
IFN1@ (interferon, type 1, cluster, also called IFNα) has been extensively studied as a treatment for patients with chronic myeloid leukemia (CML). The mechanism of anticancer activity of IFN1@ is complex and not well understood. Here, we demonstrate that autophagy
Tiejian Nie et al.
Cell death & disease, 7(12), e2563-e2563 (2016-12-30)
Endoplasmic reticulum (ER) stress is involved in many cellular processes. Emerging evidence suggests that ER stress can trigger autophagy; however, the mechanisms by which ER stress regulates autophagy and its role in this condition are not fully understood. HIV Tat-interactive
Min Liu et al.
Toxicology letters, 283, 106-115 (2017-11-13)
Mitochondrial aldehyde dehydrogenase 2 (ALDH2), an important enzyme in the elimination of toxic aldehydes, is involved in cardioprotection against diabetes mellitus. This study was designed to examine the mechanism behind ALDH2-offered protection against high glucose exposure with a focus on
Yalitza Lopez Corcino et al.
Scientific reports, 9(1), 669-669 (2019-01-27)
Little is known about strategies used by pathogens to facilitate CNS invasion. Toxoplasma gondii reaches the CNS by circulating in blood within leukocytes or as extracellular tachyzoites. T. gondii induces EGFR signaling in vitro during invasion of mammalian cells. We
Arup Sarkar et al.
The Journal of infectious diseases, 216(12), 1655-1666 (2017-10-14)
Macrophages are specialized phagocytic cells involved in clearing invading pathogens. Previously we reported that engulfment and cell motility protein 1 (ELMO1) in macrophages mediates bacterial internalization and intestinal inflammation. Here we studied the role of ELMO1 in the fate of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.