콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU099501

Sigma-Aldrich

MISSION® esiRNA

targeting human F11R

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTTTCCTACCACTGCTGAGTGGCCTGGAACTTGTTTAAAGTGTTTATTCCCCATTTCTTTGAGGGATCAGGAAGGAATCCTGGGTATGCCATTGACTTCCCTTCTAAGTAGACAGCAAAAATGGCGGGGGTCGCAGGAATCTGCACTCAACTGCCCACCTGGCTGGCAGGGATCTTTGAATAGGTATCTTGAGCTTGGTTCTGGGCTCTTTCCTTGTGTACTGACGACCAGGGCCAGCTGTTCTAGAGCGGGAATTAGAGGCTAGAGCGGCTGAAATGGTTGTTTGGTGATGACACTGGGGTCCTTCCATCTCT

Ensembl | 인체 수납 번호

ENSG00000158769

NCBI 수납 번호

NM_144504

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... F11R(50848) , F11R(50848)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jonas Franz et al.
PloS one, 11(1), e0146598-e0146598 (2016-01-06)
Endothelial barriers have a central role in inflammation as they allow or deny the passage of leukocytes from the vasculature into the tissue. To bind leukocytes, endothelial cells form adhesive clusters containing tetraspanins and ICAM-1, so-called endothelial adhesive platforms (EAPs).
Min Xie et al.
Cancer letters, 443, 67-79 (2018-12-07)
Multiple studies have revealed that long non-coding RNAs (lncRNAs) extensively participate in human cancer malignant progression. The long intergenic non-protein coding RNA 707 (LINC00707), 3087 bp in length, was recently reported to be an essential oncogene in promoting lung adenocarcinoma
Rodrigo G B Cruz et al.
Cancers, 13(4) (2021-03-07)
The success of breast cancer therapies targeting the human epidermal growth factor receptor-2 (HER2) is limited by the development of drug resistance by mechanisms including upregulation of HER3. Having reported that HER2 expression and resistance to HER2-targeted therapies can be
Nikola Sladojevic et al.
Neurobiology of disease, 67, 57-70 (2014-03-25)
Proinflammatory mediators trigger intensive postischemic inflammatory remodeling of the blood-brain barrier (BBB) including extensive brain endothelial cell surface and junctional complex changes. Junctional adhesion molecule-A (JAM-A) is a component of the brain endothelial junctional complex with dual roles: paracellular route
Hüseyin Tuncay et al.
Nature communications, 6, 8128-8128 (2015-08-27)
Planar spindle orientation in polarized epithelial cells depends on the precise localization of the dynein-dynactin motor protein complex at the lateral cortex. The contribution of cell adhesion molecules to the cortical localization of the dynein-dynactin complex is poorly understood. Here

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.