콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU070071

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF12A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAGAGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGACAATGTGCCCCCTGCCAGCCGGGGCTCGCCCACTCATCATTCATTCATCCATTCTAGAGCCAGTCTCTGCCTCCCAGACGCGGCGGGAGCCAAGCTCCTCCAACCACAAGGGGGGTGGGGGGCGGTGAATCACCTCTGAGGCCTGGGCCCAGGGTTCAGGGGAACCTTCCAAGGTGTCTGGTTGCCCTGCCTCTGGCTCCAGAACAGAAAGGGAGCCTCACGCTGGCTCACACAAAACAGCTGACACTGACTAAGGAACTGCAGCATTTGCACAGGGGAGGGGGGTGCCCTCCTTCCTAGAGGCCCTGGGGGCCAGGCTGACTTGGGGGGCAGACTTGACACTAGGCCC

Ensembl | 인체 수납 번호

ENSG00000006327

NCBI 수납 번호

NM_016639

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TNFRSF12A(51330) , TNFRSF12A(51330)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xuefeng Qi et al.
Frontiers in cellular and infection microbiology, 7, 315-315 (2017-07-27)
TLR4 in intestinal epithelial cells has been shown both inflammatory and homeostatic roles following binding of its cognate ligand lipopolysaccharide (LPS). TWEAK-Fn14 axis plays an important role in pathologies caused by excessive or abnormal inflammatory responses. This study aimed to
Zhengwei Li et al.
American journal of translational research, 8(12), 5386-5398 (2017-01-13)
Angiotesin II (Ang II) plays an important role in cardiac remodeling. Fibroblast growth factor inducible-14 (Fn14) is the smallest member of the tumor necrosis factor superfamily of receptors. Currently, little is known about the functional role of Fn14 in the
Li Hao et al.
Journal of cellular and molecular medicine, 22(9), 4344-4353 (2018-07-05)
Atrial myocyte hypertrophy is one of the most important substrates in the development of atrial fibrillation (AF). The TWEAK/Fn14 axis is a positive regulator of cardiac hypertrophy in cardiomyopathy. This study therefore investigated the effects of Fn14 on atrial hypertrophy
Alison Roos et al.
Molecular cancer research : MCR, 16(7), 1185-1195 (2018-05-05)
Glioblastoma multiforme (GBM) is the most common brain malignancies in adults. Most GBM patients succumb to the disease less than 1 year after diagnosis due to the highly invasive nature of the tumor, which prevents complete surgical resection and gives
Xuefeng Qi et al.
The Journal of general virology, 99(1), 36-43 (2017-12-09)
The pathogenesis of H9N2 subtype avian influenza virus (AIV) infection in hens is often related to oviduct tissue damage. Our previous study suggested that H9N2 AIV induces cellular apoptosis by activating reactive oxygen species (ROS) accumulation and mitochondria-mediated apoptotic signalling
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.