콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU065291

Sigma-Aldrich

MISSION® esiRNA

targeting human NFAT5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATCCTATTGCCGATGCTCAGAACCTTTCCCAGGAAACTCAAGGTTCTCTCTTTCATAGTCCAAATCCTATTGTCCACAGTCAGACTTCTACAACCTCCTCTGAACAAATGCAGCCTCCAATGTTTCACTCTCAAAGTACCATTGCTGTGTTACAGGGCTCTTCAGTTCCTCAAGACCAGCAGTCAACCAACATATTTCTTTCCCAGAGTCCCATGAATAATCTTCAGACTAACACAGTAGCCCAAGAAGCATTTTTTGCAGCACCGAACTCAATTTCTCCACTTCAGTCAACATCAAACAGTGAACAACAAGCTGCTTTCCAACAGCAAGCTCCAATATCACACATCCAGACTCCTATGCTTTCCCAAGAACAGGCACAACCCCCGCAGCAGGGTTTATTTCAGCCTCAGGTGGCCCTGGGCTCCCTTCCACCTAATCCAATGCCTCAAAGCCAACAAGGAACCAT

Ensembl | 인체 수납 번호

ENSG00000102908

NCBI 수납 번호

NM_006599

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NFAT5(10725) , NFAT5(10725)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Moritz Veltmann et al.
PloS one, 11(1), e0147312-e0147312 (2016-01-23)
Although systemic hypertension is a risk factor of age-related macular degeneration, antihypertensive medications do not affect the risk of the disease. One condition that induces hypertension is high intake of dietary salt resulting in increased blood osmolarity. In order to
Sandrine Herbelet et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Glucocorticoids are drugs of choice in Duchenne muscular dystrophy (DMD), prolonging patients' ambulation. Their mode of action at the protein level is not completely understood. In DMD, muscle tissue is replaced by fibrotic tissue produced by fibroblasts, reducing mobility. Nuclear
Saseong Lee et al.
Journal of immunology (Baltimore, Md. : 1950), 201(2), 359-370 (2018-05-26)
Fibroblast-like synoviocytes (FLSs) play a key role in the progression of rheumatoid arthritis (RA) as a primary component of invasive hypertrophied pannus. FLSs of RA patients (RA-FLSs) exhibit cancer-like features, including promigratory and proinvasive activities that largely contribute to joint
Sandrine Herbelet et al.
International journal of molecular sciences, 21(21) (2020-10-30)
Duchenne muscular dystrophy (DMD) is characterized by chronic inflammation and fibrotic tissue production by fibroblasts. The promyogenic factor nuclear factor of activated T-cells 5 (NFAT5) is virtually present in all cells, responding to hyperosmolar or pro-inflammatory stress. In embryogenic fibroblasts
Kunihiko Umekita et al.
Clinical and experimental rheumatology, 37(5), 834-841 (2019-02-16)
Damage-associated molecular patterns (DAMPs) are proposed to drive aberrant stimulation of Toll-like receptors (TLRs) in rheumatoid arthritis (RA) inflamed joints. In the current study we investigated the role of the neutrophil-derived lactoferrin (LTF), as an endogenous ligand for TLR4 in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.