콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU050291

Sigma-Aldrich

MISSION® esiRNA

targeting human MLH1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAGAGGAAGATGGTCCCAAAGAAGGACTTGCTGAATACATTGTTGAGTTTCTGAAGAAGAAGGCTGAGATGCTTGCAGACTATTTCTCTTTGGAAATTGATGAGGAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAGGTGAATTGGGACGAAGAAAAGGAATGTTTTGAAAGCCTCAGTAAAGAATGCGCTATGTTCTATTCCATCCGGAAGCAGTACATATCTGAGGAGTCGACCCTCTCAGGCCAGCAGAGTGAAGTGCCTGGCTCCATTCCAAACTCCTGGAAGTGGACTGTGGAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCTAAACATTTCACAGAAGATGGAAATATCCTGCAGCTTGCTAACCTGCCTGATC

Ensembl | 인체 수납 번호

ENSG00000076242

NCBI 수납 번호

NM_000249

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MLH1(4292) , MLH1(4292)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Jinfeng Cui et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 115, 205-211 (2018-03-17)
Sterigmatocystin (ST), being a precursor of aflatoxin, is categorized as Group 2B carcinogen. Our previous studies found that both mismatch repair (MMR) pathways and p53 signaling pathway were involved in ST-induced G2 cell cycle arrest in human esophageal squamous epithelial
Jun-Yu Lu et al.
Oncotarget, 8(24), 38767-38779 (2017-04-14)
Epidemiological data demonstrated that hormone replace treatment has protective effect against colorectal cancer (CRC). Our previous studies showed that this effect may be associated with DNA mismatch repair. This study aims to investigate the mechanism of estrogen induction of MLH1
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.