추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAGCTCAAGTGGTCCTTTGCTGTTGCTACCATCACAGAAATCCCCCCCGTTATCTTCCTCCCCAACTTCCTTGTGCAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACCATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCTCCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCGTGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGACTTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTGCCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGTGGAGAGGAACATCAAGAAATCCCTCCAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HDAC11(79885) , HDAC11(79885)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Li Yuan et al.
Journal of molecular and cellular cardiology, 122, 1-10 (2018-08-01)
Immune deregulation is a causative factor in pathogenesis of myocarditis. Histone deacetylases (HDAC) involve multiple biochemical activities in the cell. This study aims to elucidate the role of HDAC11 in the regulation of interleukin (IL)-13-expression in CD4+ T cells of
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of
Shashi Bala et al.
Journal of leukocyte biology, 102(2), 487-498 (2017-06-07)
Inflammation promotes the progression of alcoholic liver disease. Alcohol sensitizes KCs to gut-derived endotoxin (LPS); however, signaling pathways that perpetuate inflammation in alcoholic liver disease are only partially understood. We found that chronic alcohol feeding in mice induced miR-155, an
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU020301-50UG | 4061828340279 |
| EHU020301-20UG | 4061828575039 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.