Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU010011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGACACTGGGGGTAACATCGCTTTTTCCCAATCTCACAAATTTACAAACCCTCAGGATAGGAAATGTAGAGACTTTCAGTGAGATAAGGAGAATAGATTTTGCTGGGCTGACTTCTCTCAATGAACTTGAAATTAAGGCATTAAGTCTCCGGAATTATCAGTCCCAAAGTCTAAAGTCGATCCGCGACATCCATCACCTGACTCTTCACTTAAGCGAGTCTGCTTTCCTGCTGGAGATTTTTGCAGATATTCTGAGTTCTGTGAGATATTTAGAACTAAGAGATACTAACTTGGCCAGGTTCCAGTTTTCACCACTGCCCGTAGATGAAGTCAGCTCACCGATGAAGAAGCTGGCATTCCGAGGCTCGGTTCTCACTGATGAAAGCTTTAACGAGCTCCTGAAGCTGTTGCGTTACA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Seok-Seong Kang et al.
Cytokine, 75(1), 174-180 (2015-05-20)
Staphylococcus aureus can cause the intestinal inflammatory diseases. However, little is known about the molecular mechanism of S. aureus infection in the intestine. In the present study, we investigated whether S. aureus could stimulate human intestinal epithelial cells triggering inflammation.
Helge Haarmann et al.
Biochemical and biophysical research communications, 467(1), 46-52 (2015-09-30)
Bacterial colonisation with Moraxella catarrhalis may partly sustain chronic inflammation in the lower airways of patients with chronic obstructive pulmonary disease (COPD). In addition, this bacterium causes infectious exacerbations of COPD, which often necessitate treatment with antibiotics. Antimicrobial peptides are
Megumi Inomata et al.
PloS one, 13(8), e0202791-e0202791 (2018-08-29)
Porphyromonas gingivalis possesses various abilities to evade and disrupt host immune responses, by which it acts as an important periodontal pathogen. P. gingivalis produces outer membrane protein A (OmpA)-like proteins (OmpALPs), Pgm6 and Pgm7, as major O-linked glycoproteins, but their
Seung Heon Shin et al.
Allergy, asthma & immunology research, 8(1), 63-68 (2015-11-06)
Chronic rhinosinusitis with nasal polyps is a chronic inflammatory disease with markedly increased eosinophils, Th2-type lymphocytes, fibroblasts, and goblet cells. Fungi are commonly associated with airway inflammatory diseases, and thymic stromal lymphopoietin (TSLP) is important in the development of Th2
Min Li et al.
Biochemical and biophysical research communications, 466(4), 748-754 (2015-10-02)
Microphage apoptosis is a critical event in atherosclerotic lesions in patients with diabetes. In the present investigation, high glucose treatment inhibited Akt phosphorylation and activated caspase 3 in primary peritoneal macrophage, leading to cell apoptosis. Hypoxia prolonged macrophage survival in

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.