Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU033441

Sigma-Aldrich

MISSION® esiRNA

targeting human XPC

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGTTTCAATAAAGGGGTCCATGAGGACACACACAAGGTTCACCTTCTCTGCCTGCTAGCAAATGGCTTCTATCGAAATAACATCTGCAGCCAGCCAGATCTGCATGCTATTGGCCTGTCCATCATCCCAGCCCGCTTTACCAGAGTGCTGCCTCGAGATGTGGACACCTACTACCTCTCAAACCTGGTGAAGTGGTTCATTGGAACATTTACAGTTAATGCAGAACTTTCAGCCAGTGAACAAGATAACCTGCAGACTACATTGGAAAGGAGATTTGCTATTTACTCTGCTCGAGATGATGAGGAATTGGTCCATATATTCTTACTGATTCTCCGGGCTCTGCAGCTCTTGACCCGGCTGGTATTGTCTCTACAGCCAATTCCTCTGAAGTCAGCAACAGCAAAGGGAAAGA

N° accesso Ensembl | uomo

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Timothy Budden et al.
BMC cancer, 18(1), 100-100 (2018-01-28)
Melanoma has two key features, an over-representation of UV-induced mutations and resistance to DNA damaging chemotherapy agents. Both of these features may result from dysfunction of the nucleotide excision repair pathway, in particular the DNA damage detection branch, global genome
Jyh-Cheng Chen et al.
Pharmacology, 102(1-2), 91-104 (2018-06-29)
Etoposide (VP16) is a topoisomerase II inhibitor and has been used for the treatment of non-small cell lung cancer (NSCLC). Xeroderma pigmentosum complementation group C (XPC) protein is a DNA damage recognition factor in nucleotide excision repair and involved in
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine
Jyh-Cheng Chen et al.
Toxicology research, 7(6), 1247-1256 (2018-12-18)
Astaxanthin has been demonstrated to exhibit a wide range of beneficial effects that include anti-cancer and anti-inflammatory properties. Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair and is involved in
Tiantian Cui et al.
Oncotarget, 6(12), 10060-10072 (2015-04-15)
Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair. Deletion of XPC is associated with early stages of human lung carcinogenesis, and reduced XPC mRNA levels predict poor patient outcome for

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.