Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU060821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egr1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGGGAGAGGCAGGAAAGACATAAAAGCACAGGAGGGAAGAGATGGCCGCAAGAGGGGCCACCTCTTAGGTCAGATGGAAGATCTCAGAGCCAAGTCCTTCTACTCACGAGTAGAAGGACCGTTGGCCAACAGCCCTTTCACTTACCATCCCTGCCTCCCCCGTCCTGTTCCCCTTTTGACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGGACTTGATTTGCATGGTATTGGATAAATCATTTCAGTATCCTCTCCATCACATGCCTGGCCCTTGCTCCCTTCAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG

Ensembl | nº de acceso | ratón

ENSMUSG00000038418

Nº de acceso NCBI

NM_007913

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... EGR1(13653) , Egr1(13653)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming Yang et al.
Breast cancer research and treatment, 158(2), 277-286 (2016-07-06)
Sulforaphene (SFE, 4-methylsufinyl-3-butenyl isothiocyanate) is a member of isothiocyanates, which is derived from radish seeds. It has shown that multiple isothiocyanates, such as sulforaphane, can effectively inhibit cancer cell proliferation in vitro and in vivo. However, it is still largely
Qiang Chen et al.
BMC molecular and cell biology, 21(1), 80-80 (2020-11-11)
Arecoline is an alkaloid natural product found in the areca nut that can induce oral submucous fibrosis and subsequent development of cancer. However, numerous studies have shown that arecoline may inhibit fibroblast proliferation and prevent collagen synthesis. High doses of
Kazuhide Hayakawa et al.
Stem cell research, 12(2), 531-538 (2014-02-01)
Endothelial progenitor cells (EPCs) may contribute to neurovascular repair after stroke and neurodegeneration. A key step in this process should involve adhesive interactions between EPCs and the targeted cerebral endothelium. Here, we tested the hypothesis that reactive astrocytes may play
Sai Vikram Vemula et al.
Antiviral research, 139, 161-170 (2016-11-28)
The HIV latent CD4 Human CD4 Treatment of primary human CD4 Overall, our results offer new insights into the mechanism of action of PKC agonists, biomarkers of pathway engagement, and the potential role of EGR family in HIV reactivation.
Prontip Saelee et al.
Frontiers in immunology, 8, 383-383 (2017-04-26)
The transcription factor Ets1 is highly expressed in B lymphocytes. Loss of Ets1 leads to premature B cell differentiation into antibody-secreting cells (ASCs), secretion of autoantibodies, and development of autoimmune disease. Despite the importance of Ets1 in B cell biology
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico