Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU081921

Sigma-Aldrich

MISSION® esiRNA

targeting human ACLY

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCCCCATGGAGTTTGTGAACAAGATGAAGAAGGAAGGGAAGCTGATCATGGGCATTGGTCACCGAGTGAAGTCGATAAACAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAGGCAGCACTTCCCTGCCACTCCTCTGCTCGATTATGCACTGGAAGTAGAGAAGATTACCACCTCGAAGAAGCCAAATCTTATCCTGAATGTAGATGGTCTCATCGGAGTCGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAGGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGGTTCATTGGACACTATCTTGATCAGAAGAGGCTGAAGCAGGGGCTGTATCGTCATCCGTGGG

Ensembl | nº de acceso humano

ENSG00000131473

Nº de acceso NCBI

NM_198830

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ACLY(47) , ACLY(47)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mei Xin et al.
Oncotarget, 7(28), 44252-44265 (2016-06-19)
MicroRNAs (miRNAs) are non-coding small RNAs that function as negative regulators of gene expression involving in the tumor biology. ATP citrate lyase (ACLY), a key enzyme initiating de novo lipid synthesis, has been found to be upregulated in cancer cells
Supriya Shah et al.
Oncotarget, 7(28), 43713-43730 (2016-06-02)
The androgen receptor (AR) plays a central role in prostate tumor growth. Inappropriate reactivation of the AR after androgen deprivation therapy promotes development of incurable castration-resistant prostate cancer (CRPC). In this study, we provide evidence that metabolic features of prostate
Li Lai et al.
Circulation, 139(1), 119-133 (2018-12-28)
We have previously shown that activation of cell-autonomous innate immune signaling facilitates the transdifferentiation of fibroblasts into induced endothelial cells, and is required to generate induced endothelial cells with high fidelity for endothelial lineage. Recent studies indicate that a glycolytic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico