Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU076761

Sigma-Aldrich

MISSION® esiRNA

targeting human EGFR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Meifang Li et al.
Journal of experimental & clinical cancer research : CR, 38(1), 211-211 (2019-05-24)
Epidermal growth factor receptor (EGFR) and epidermal growth factor receptor pathway substrate 8 (Eps8) have been widely reported to be expressed in various tumors. Eps8 is an important active kinase substrate of EGFR that directly binds to the juxtamembrane (JXM)
Yi-Yang Peng et al.
Biomacromolecules, 19(10), 4052-4058 (2018-08-31)
Strong signaling cascades derived from upregulation and overexpression of growth factors such as the EGF-family (epidermal growth factors) have been crucially related to cancer pathogenesis. Gene silencing techniques to modulate the expression of oncogenes and tumor suppresor genes are a
Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Jia Shen et al.
Journal of experimental & clinical cancer research : CR, 37(1), 157-157 (2018-07-19)
Lycorine has been revealed to inhibit the development of many kinds of malignant tumors, including glioblastoma multiforme (GBM). Although compelling evidences demonstrated Lycorine's inhibition on cancers through some peripheral mechanism, in-depth mechanism studies of Lycotine's anti-GBM effects still call for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico