Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU030401

Sigma-Aldrich

MISSION® esiRNA

targeting human MELK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAAACCCAAGGGTAACAAGGATTACCATCTACAGACATGCTGTGGGAGTCTGGCTTATGCAGCACCTGAGTTAATACAAGGCAAATCATATCTTGGATCAGAGGCAGATGTTTGGAGCATGGGCATACTGTTATATGTTCTTATGTGTGGATTTCTACCATTTGATGATGATAATGTAATGGCTTTATACAAGAAGATTATGAGAGGAAAATATGATGTTCCCAAGTGGCTCTCTCCCAGTAGCATTCTGCTTCTTCAACAAATGCTGCAGGTGGACCCAAAGAAACGGATTTCTATGAAAAATCTATTGAACCATCCCTGGATCATGCAAGATTACAACTATCCTGTTGAGTGGCAAAGCAAGAATCCTTTTATTCACCTCGATGATGATTGCGTAACAGAACTTTCTGTACATCACAGAAACAACAGGCAAACAATGGAGGATTTAATTTCACTGTGGCAGTATGATCACCTCACGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ke Wang et al.
Oncology reports, 39(6), 2777-2786 (2018-04-06)
Retinoblastoma (Rb) is the most frequent primary intraocular tumor usually diagnosed in infants and children, and current therapy for such disease is still limited. Corosolic acid (CA), an ursane-type pentacyclic triterpene, has been assessed as a promising anticancer agent with little impact
Gang Li et al.
Oncology letters, 15(6), 9934-9940 (2018-05-29)
Maternal embryonic leucine zipper kinase (MELK) is an important regulator in tumorigenesis of human breast cancer, and if silenced leads to programmed cell death in specific breast cancer cell lines, including MDA-MB-231 cells. In the present study, RNA interference, proliferation
Antonio Cigliano et al.
Medicina (Kaunas, Lithuania), 56(1) (2019-12-22)
Background and Objectives: Intrahepatic cholangiocarcinoma (iCCA) is a pernicious tumor characterized by a dismal outcome and scarce therapeutic options. To substantially improve the prognosis of iCCA patients, a better understanding of the molecular mechanisms responsible for development and progression of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico