Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU047641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brca1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGACTCCTTCCCAGGACAACTAGGTAGAAACAGAGGGCCTAAGGTGAACACTGTGCCTCCATTAGATAGTATGCAGCCTGGTGTCTGTCAGCAAAGTGTTCCTGTAAGTGATAAGTATCTTGAAATAAAAAAGCAGGAGGGTGAGGCTGTCTGTGCAGACTTCTCTCCATGTCTATTCTCAGACCATCTTGAGCAATCTATGAGTGGTAAGGTTTTTCAGGTTTGCTCTGAGACACCTGATGACCTGCTGGATGATGTTGAAATACAGGGACATACTAGCTTTGGTGAAGGTGACATAATGGAGAGATCTGCTGTCTTTAACGGAAGCATCCTGAGAAGGGAGTCCAGTAGGAGCCCTAGTCCTGTAACCCATGCATCGAAGTCTCAGAGTCTCCACAGAGCGTCTAGGAA

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000017146

NCBI-Hinterlegungsnummer

NP_033894

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... BRCA1(12189) , Brca1(12189)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Samir Acharya et al.
PloS one, 9(8), e103819-e103819 (2014-08-02)
Fifteen percent of tumors utilize recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. The mechanisms underlying ALT are unclear but involve several proteins involved in homologous recombination including the BLM helicase, mutated in Bloom's syndrome, and the BRCA1 tumor
Monique G P van der Wijst et al.
Molecular oncology, 9(7), 1259-1273 (2015-04-07)
Risk factors indicate the importance of oxidative stress during ovarian carcinogenesis. To tolerate oxidative stress, cells activate the transcription factor Nrf2 (Nfe2l2), the master regulator of antioxidant and cytoprotective genes. Indeed, for most cancers, hyperactivity of Nrf2 is observed, and
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.