Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU031451

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACA

Ensembl | Human Hinterlegungsnummer

ENSG00000139618

NCBI-Hinterlegungsnummer

NM_000059

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... BRCA2(675) , BRCA2(675)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sukrit Mahajan et al.
The international journal of biochemistry & cell biology, 107, 128-139 (2018-12-28)
Cancer cells exhibit HR defects, increased proliferation and checkpoint aberrations. Tumour suppressor proteins, BRCA2 and p53 counteract such aberrant proliferation by checkpoint regulation. Intriguingly, chemo-resistant cancer cells, exhibiting mutated BRCA2 and p53 protein survive even with increased DNA damage accumulation.
Zihao Pan et al.
Annals of translational medicine, 7(23), 777-777 (2020-02-12)
Colon adenocarcinoma (CA) is the most common one with poor survival in colon cancer. This study aims to investigate the effect of miR-1245a on the process of CA cells and its target gene BRCA2. The expression of CA tissues and
Zdenek Skrott et al.
Oncogene, 38(40), 6711-6722 (2019-08-09)
Aldehyde dehydrogenase (ALDH) is a proposed biomarker and possible target to eradicate cancer stem cells. ALDH inhibition as a treatment approach is supported by anti-cancer effects of the alcohol-abuse drug disulfiram (DSF, Antabuse). Given that metabolic products of DSF, rather
Joshua R Heyza et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(8), 2523-2536 (2018-12-13)
ERCC1/XPF is a DNA endonuclease with variable expression in primary tumor specimens, and has been investigated as a predictive biomarker for efficacy of platinum-based chemotherapy. The failure of clinical trials utilizing ERCC1 expression to predict response to platinum-based chemotherapy suggests
Weixing Zhao et al.
Nature, 550(7676), 360-365 (2017-10-05)
The tumour suppressor complex BRCA1-BARD1 functions in the repair of DNA double-stranded breaks by homologous recombination. During this process, BRCA1-BARD1 facilitates the nucleolytic resection of DNA ends to generate a single-stranded template for the recruitment of another tumour suppressor complex
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.