Direkt zum Inhalt
Merck

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rob M Ewing et al.
Journal of proteome research, 17(6), 2216-2225 (2018-05-12)
The dysregulation of Wnt signaling is a frequent occurrence in many different cancers. Oncogenic mutations of CTNNB1/β-catenin, the key nuclear effector of canonical Wnt signaling, lead to the accumulation and stabilization of β-catenin protein with diverse effects in cancer cells.
Izabela Janus et al.
Acta veterinaria Hungarica, 64(1), 90-102 (2016-02-27)
Primary heart tumours affect less than 1% of dogs. Due to their rare incidence, every research showing the frequency of cardiac tumours is valuable. Routine diagnostics is often complemented with immunohistochemical analysis. This study was conducted on 110 patient records
Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Bing Z Carter et al.
Cancer research, 79(6), 1165-1177 (2019-01-25)
The apoptosis repressor with caspase recruitment domain (ARC) protein is a strong independent adverse prognostic marker in acute myeloid leukemia (AML). We previously reported that ARC regulates leukemia-microenvironment interactions through the NFκB/IL1β signaling network. Malignant cells have been reported to
Pradip De et al.
Oncotarget, 8(2), 3072-3103 (2016-12-03)
The acquisition of integrin-directed metastasis-associated (ID-MA) phenotypes by Triple-Negative Breast Cancer (TNBC) cells is caused by an upregulation of the Wnt-beta-catenin pathway (WP). We reported that WP is one of the salient genetic features of TNBC. RAC-GTPases, small G-proteins which

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.