Direkt zum Inhalt
Merck

EHU063791

Sigma-Aldrich

MISSION® esiRNA

targeting human LMNA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Berta N Vazquez et al.
Nucleic acids research, 47(15), 7870-7885 (2019-06-22)
Long interspersed elements-1 (LINE-1, L1) are retrotransposons that hold the capacity of self-propagation in the genome with potential mutagenic outcomes. How somatic cells restrict L1 activity and how this process becomes dysfunctional during aging and in cancer cells is poorly
Paraskevi Sakellariou et al.
Skeletal muscle, 6, 4-4 (2016-03-01)
Studies of the pathogenic mechanisms underlying human myopathies and muscular dystrophies often require animal models, but models of some human diseases are not yet available. Methods to promote the engraftment and development of myogenic cells from individuals with such diseases
Qiao Zhang et al.
Molecular biology of the cell, 30(7), 899-906 (2018-12-20)
Cancer cell migration through narrow constrictions generates compressive stresses on the nucleus that deform it and cause rupture of nuclear membranes. Nuclear membrane rupture allows uncontrolled exchange between nuclear and cytoplasmic contents. Local tensile stresses can also cause nuclear deformations
Camilla Evangelisti et al.
Cells, 9(3) (2020-04-03)
A type lamins are fundamental components of the nuclear lamina. Changes in lamin A expression correlate with malignant transformation in several cancers. However, the role of lamin A has not been explored in osteosarcoma (OS). Here, we wanted to investigate
Mariana Reis-Sobreiro et al.
Cancer research, 78(21), 6086-6097 (2018-08-30)
Abnormalities in nuclear shape are a well-known feature of cancer, but their contribution to malignant progression remains poorly understood. Here, we show that depletion of the cytoskeletal regulator, Diaphanous-related formin 3 (DIAPH3), or the nuclear membrane-associated proteins, lamin A/C, in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.