Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU094061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg7

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTTTCTGCTCCTGACCTTCGCGGACCTAAAGAAGTACCACTTCTACTACTGGTTTTGCTGCCCCGCCCTCTGTCTTCCTGAGAGCATCCCTCTAATCCGGGGACCTGTGAGCTTGGATCAAAGGCTTTCACCAAAACAGATCCAGGCCCTGGAGCATGCCTATGATGATCTGTGTCGAGCCGAAGGCGTCACGGCCCTGCCCTACTTCTTATTCAAGTACGATGACGACACTGTTCTGGTCTCCTTGCTCAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACAAAGATAACAGTTGGTGTGTACGATCCCTGTAACCTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTGGCAGCCCACAGATGGAGCGGCAGTTTCCAGTCCGTTGAAGTCC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Bingrong Tang et al.
PloS one, 9(7), e103364-e103364 (2014-07-26)
The two major intracellular protein degradation systems, the ubiquitin-proteasome system (UPS) and autophagy, work collaboratively in many biological processes including development, apoptosis, aging, and countering oxidative injuries. We report here that, in human retinal pigment epithelial cells (RPE), ARPE-19 cells
Hong-Guang Xia et al.
The Journal of cell biology, 210(5), 705-716 (2015-09-02)
Hexokinase II (HK2), a key enzyme involved in glucose metabolism, is regulated by growth factor signaling and is required for initiation and maintenance of tumors. Here we show that metabolic stress triggered by perturbation of receptor tyrosine kinase FLT3 in
Marco B E Schaaf et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 114(3), 406-412 (2015-03-18)
(Pre)clinical studies indicate that autophagy inhibition increases response to anti-cancer therapies. Although promising, due to contradicting reports, it remains unclear if radiation therapy changes autophagy activity and if autophagy inhibition changes the cellular intrinsic radiosensitivity. Discrepancies may result from different
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
Rong Zheng et al.
Oncotarget, 6(19), 17417-17429 (2015-05-31)
Radiation therapy has an important role in the treatment of breast cancer. Dysfunction p53 and hypoxia are typical biological characteristics of breast cancer that constitute barriers to the efficacy of radiotherapy. Mitophagy plays a protective role in cellular homeostasis under

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.