Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU041221

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gpr109a

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCTTGCTTCTTGTGGGGTCTCACCATCGGCCTGACTGTCCACCTCCTCTATACAAACATGATGACCAAAAATGGCGAGGCATATCTGTGTAGCAGCTTCAGCATCTGTTACAACTTCAGGTGGCACGATGCTATGTTCCTCTTGGAATTCTTCTTGCCCCTGGCCATCATCTTGTTCTGCTCAGGCAGGATCATCTGGAGCCTGAGGCAGAGACAGATGGACAGACATGCCAAGATCAAGAGGGCCATCAACTTCATCATGGTGGTGGCTATTGTATTCATCATTTGCTTCCTACCCAGTGTGGCTGTGCGCATCCGCATCTTCTGGCTTCTCTACAAATATAACGTACGCAACTGTGACATCTACTCCTCGGTGGACCTGGCTTTCTTTACCACCCTTAGCTTTACCTACATGAACAGCATGCTGGACCCTGTGGTCTACTATTTCTCCAGCCCATCTTTCCCCAACTTCTTCTCCACGTGTATCAACCGCTGCCTTCGAAAGAAAACATTGGGTGAACCCGATA

N° accesso Ensembl | topo

ENSMUSG00000045502

N° accesso NCBI

NM_030701

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... GPR109A(80885) , Gpr109a(80885)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
JDU
VBS
AOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Genki Hayashi et al.
Human molecular genetics, 26(15), 2864-2873 (2017-05-02)
The induction of mitochondrial biogenesis could potentially alleviate mitochondrial and muscle disease. We show here that dimethyl fumarate (DMF) dose-dependently induces mitochondrial biogenesis and function dosed to cells in vitro, and also dosed in vivo to mice and humans. The
Banabihari Giri et al.
International journal of molecular sciences, 20(18) (2019-09-22)
In this study, we used macrophage RAW264.7 cells to elucidate the molecular mechanism underlying the anti-inflammatory actions of niacin. Anti-inflammatory actions of niacin and a possible role of its receptor GPR109A have been studied previously. However, the precise molecular mechanism
Samar Rezq et al.
The Journal of pharmacology and experimental therapeutics, 356(2), 456-465 (2015-12-02)
G protein-coupled receptor 109A (GPR109A) activation by its ligand nicotinic acid (NA) in immune cells increases Ca(2+) levels, and Ca(2+) induces glutamate release and oxidative stress in central blood pressure (BP)-regulating nuclei, for example, the rostral ventrolateral medulla (RVLM), leading
Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.