Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU012051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnf

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGAAGGGAATGGGTGTTCATCCATTCTCTACCCAGCCCCCACTCTGACCCCTTTACTCTGACCCCTTTATTGTCTACTCCTCAGAGCCCCCAGTCTGTGTCCTTCTAACTTAGAAAGGGGATTATGGCTCAGAGTCCAACTCTGTGCTCAGAGCTTTCAACAACTACTCAGAAACACAAGATGCTGGGACAGTGACCTGGACTGTGGGCCTCTCATGCACCACCATCAAGGACTCAAATGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAGTGGTCAGGTTGCCTCTGTCTCAGAATGAGGCTGGATAAGATCTCAGGCCTTCCTACCTTCAGACCTTTCCAGACTCTTCCCTGAGGTGC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Valentina Pileczki et al.
International journal of molecular sciences, 14(1), 411-420 (2012-12-25)
Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine involved in the promotion and progression of cancer, including triple negative breast cancer cells. Thus, there is significant interest in understanding the molecular signaling pathways that connect TNF-α with the survival
Hank Cheng et al.
Journal of neuroinflammation, 13, 19-19 (2016-01-27)
The basis for air pollution-associated neurodegenerative changes in humans is being studied in rodent models. We and others find that the ultrafine particulate matter (PM) derived from vehicular exhaust can induce synaptic dysfunction and inflammatory responses in vivo and in
Li Peng et al.
The International journal of artificial organs, 38(10), 565-571 (2015-11-07)
Periprosthetic osteolysis, involving RANK/RANKL/osteoprotegerin (OPG) and TNF-α/NFκB signaling, contributes to bone resorption and inflammation. We constructed lentivirus vectors to inhibit TNF-α and enhance OPG expression and assessed their impacts on wear debris-induced inflammation and osteoclastogenesis in an osteoclast/osteoblast coculture system.
Wenwen Zheng et al.
Molecular pain, 7, 40-40 (2011-05-24)
HIV-associated sensory neuropathy (HIV-SN) is one of the most common forms of peripheral neuropathy, affecting about 30% of people with acquired immune deficiency syndrome (AIDS). The symptoms of HIV-SN are dominated by neuropathic pain. Glia activation in the spinal cord
Praveen Thumbikat et al.
PLoS pathogens, 5(5), e1000415-e1000415 (2009-05-05)
Urinary tract infections are the second most common infectious disease in humans and are predominantly caused by uropathogenic E. coli (UPEC). A majority of UPEC isolates express the type 1 pilus adhesin, FimH, and cell culture and murine studies demonstrate

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.