Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU150481

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF4EBP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Stabilization of 4E-BP1 by PI3K kinase and its involvement in CHK2 phosphorylation in the cellular response to radiation.
Zi-Jian Yu et al.
International journal of medical sciences, 14(5), 452-461 (2017-05-26)
Jin Young Sung et al.
Experimental gerontology, 109, 51-58 (2017-08-12)
Cellular senescence is related to aging and extremely stable proliferative arrest with active metabolism. Senescent cells can activate mammalian target of rapamycin (mTOR) pathway, which plays a crucial role in the regulation of cell metabolism, cellular growth, and autophagy in
Thomas Graillon et al.
Oncotarget, 8(33), 55361-55373 (2017-09-15)
Pasireotide is a somatostatin analog (SSA) that targets somatostatin receptor subtype 1 (SST1), SST2, SST3, and SST5 with a high affinity. Pasireotide has a better antisecretory effect in acromegaly, Cushing's disease, and neuroendocrine tumors than octreotide. In this study, we
Yuan-Chin Lee et al.
Cancer letters, 432, 191-204 (2018-06-19)
The present study aimed to investigate the pathway related to MCL1 expression in ABT-263-treated human leukemia U937 cells. ABT-263 upregulated MCL1 protein expression but did not affect its mRNA level and protein stability. Notably, ABT-263 increased 4EBP1 mRNA decay and thus
Lianhe Zheng et al.
Molecules and cells, 37(2), 118-125 (2014-03-07)
Osteosarcoma is the most common primary malignant bone tumor with a very poor prognosis. Treating osteosarcoma remains a challenge due to its high transitivity. Tenascin-C, with large molecular weight variants including different combinations of its alternative spliced FNIII repeats, is

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.