Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU131661

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCB1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCATGCTCAGACAGGATGTGAGTTGGTTTGATGACCCTAAAAACACCACTGGAGCATTGACTACCAGGCTCGCCAATGATGCTGCTCAAGTTAAAGGGGCTATAGGTTCCAGGCTTGCTGTAATTACCCAGAATATAGCAAATCTTGGGACAGGAATAATTATATCCTTCATCTATGGTTGGCAACTAACACTGTTACTCTTAGCAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGACAAGCACTGAAAGATAAGAAAGAACTAGAAGGTTCTGGGAAGATCGCTACTGAAGCAATAGAAAACTTCCGAACCGTTGTTTCTTTGACTCAGGAGCAGAAGTTTGAACATATGTATGCTCAGAGTTTGCAGGTACCATACAGAAACTCTTTGAGGAAAGCACACATCTTTGGAATTACATTTTCCTTCACCCAGGCAATGATGTA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ho Kyung Seo et al.
The Prostate, 80(6), 453-462 (2020-03-07)
Docetaxel is the preferred chemotherapeutic agent for hormone-refractory prostate cancer (PC) patients. However, patients eventually develop docetaxel resistance, and no effective treatment options are available for them. We aimed to establish docetaxel resistance in castration-resistant prostate cancer (CRPC) cell lines
Michael Jelínek et al.
Toxicology and applied pharmacology, 347, 79-91 (2018-04-07)
We tested the role of substituents at the C3' and C3'N positions of the taxane molecule to identify taxane derivatives capable of overcoming acquired resistance to paclitaxel. Paclitaxel-resistant sublines SK-BR-3/PacR and MCF-7/PacR as well as the original paclitaxel-sensitive breast cancer
Tao Wang et al.
Theranostics, 5(12), 1456-1472 (2015-12-19)
Understanding the molecular basis of drug resistance and utilising this information to overcome chemoresistance remains a key challenge in oncology. Here we report that survivin, a key protein implicated in drug resistance, is overexpressed in cancer stem cell pool of
Xiaoqian Yang et al.
Pharmaceutical research, 32(6), 2097-2109 (2014-12-18)
Approaches for the synthesis of biomaterials to facilitate the delivery of "biologics" is a major area of research in cancer therapy. Here we designed and characterized a hyaluronic acid (HA) based self-assembling nanoparticles that can target CD44 receptors overexpressed on
Vlasta Němcová-Fürstová et al.
Toxicology and applied pharmacology, 310, 215-228 (2016-09-25)
Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.