Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU113561

Sigma-Aldrich

MISSION® esiRNA

targeting human NOTCH2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCAGTGTCGAGATGGCTATGAACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAAGGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGGACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAGGACTGCCAGTACTCAACATCTCATCCATGCTTTGTGTCTCGACCCTGCCTGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGACGGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAGTACCTGTACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGGCTTCACAGGGCAGAAATGTGAGA

N° accesso Ensembl | uomo

ENSG00000134250

N° accesso NCBI

NM_024408

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NOTCH2(100132406) , NOTCH2(388677)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
DCT
YUS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiaoyuan Wang et al.
Stem cell research & therapy, 9(1), 327-327 (2018-11-25)
Lung cancer stem cells have the ability to self-renew and are resistant to conventional chemotherapy. MicroRNAs (miRNAs) regulate and control the expression and function of many target genes; therefore, miRNA disorders are involved in the pathogenesis of human diseases, such
Rulan Bai et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3371-3384 (2018-02-03)
Embryo implantation into the uterine endometrium is required for pregnancy establishment in most mammals. By using global expression analysis, we investigated the molecules that are related to epithelial-mesenchymal transition (EMT) in noninvasive bovine trophoblasts and found that the transcription factor
Mercedes Tomé et al.
Stem cell research, 35, 101390-101390 (2019-02-15)
Notch signalling regulates neural stem cell (NSC) proliferation, differentiation and survival for the correct development and functioning of the central nervous system. Overactive Notch2 signalling has been associated with poor prognosis of aggressive brain tumours, such as glioblastoma multiforme (GBM).
Jie Deng et al.
Journal of experimental & clinical cancer research : CR, 38(1), 2-2 (2019-01-05)
Glioblastomas multiforme (GBM) is the most devastating primary intracranial malignancy lacking effective clinical treatments. Notch2 has been established to be a prognostic marker and probably involved in GBM malignant progression. N-acetylcysteine (NAC), a precursor of intracellular glutathione (GSH), has been
Jeeranan Manokawinchoke et al.
Scientific reports, 7(1), 10124-10124 (2017-09-02)
Notch signaling regulates diverse biological processes in dental pulp tissue. The present study investigated the response of human dental pulp cells (hDPs) to the indirect immobilized Notch ligand Jagged1 in vitro. The indirect immobilized Jagged1 effectively activated Notch signaling in
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.