Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU093561

Sigma-Aldrich

MISSION® esiRNA

targeting human MYCN (1)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GACGTGGTCACTGTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCACATTCACCATCACTGTGCGTCCCAAGAACGCAGCCCTGGGTCCCGGGAGCAGTCCAGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCAGCAGCACAACTATGCCGCCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAGAGCGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTGAGCCCCCGAAACTCTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCGGTCCAGCTTTCTCAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yosuke Watanabe et al.
Medical oncology (Northwood, London, England), 34(9), 158-158 (2017-08-10)
Although DNA hypermethylation at non-promoter region of the Zygote arrest 1 (ZAR1) gene has been observed in many types of tumor, including neuroblastoma (NB), the role of this gene in tumor development and/or progression is unclear. One reason is that
Huogang Wang et al.
Oncotarget, 8(49), 86312-86324 (2017-11-22)
Small cell lung cancer (SCLC) is a clinically aggressive cancer with very poor prognosis. Amplification of
Luca Montemurro et al.
Cancer research, 79(24), 6166-6177 (2019-10-17)
Approximately half of high-risk neuroblastoma is characterized by MYCN amplification. N-Myc promotes tumor progression by inducing cell growth and inhibiting differentiation. MYCN has also been shown to play an active role in mitochondrial metabolism, but this relationship is not well
T Tao et al.
Oncogene, 36(27), 3852-3867 (2017-03-07)
The nucleolar factor, digestive organ expansion factor (DEF), has a key role in ribosome biogenesis, functioning in pre-ribosomal RNA (pre-rRNA) processing as a component of the small ribosomal subunit (SSU) processome. Here we show that the peripheral sympathetic nervous system
Xiaoqin Jiang et al.
Molecular medicine reports, 18(5), 4595-4602 (2018-09-18)
Hypoxic‑ischemic encephalopathy is one of the most notable causes of brain injury in newborns. Cerebral ischemia and reperfusion lead to neuronal damage and neurological disability. In vitro and in vivo analyses have indicated that E3 ubiquitin protein ligase (Huwe1) is important for

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.