Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU078901

Sigma-Aldrich

MISSION® esiRNA

targeting human GPI

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CACCAAGGCACCAAGATGATACCCTGTGACTTCCTCATCCCGGTCCAGACCCAGCACCCCATACGGAAGGGTCTGCATCACAAGATCCTCCTGGCCAACTTCTTGGCCCAGACAGAGGCCCTGATGAGGGGAAAATCGACGGAGGAGGCCCGAAAGGAGCTCCAGGCTGCGGGCAAGAGTCCAGAGGACCTTGAGAGGCTGCTGCCACATAAGGTCTTTGAAGGAAATCGCCCAACCAACTCTATTGTGTTCACCAAGCTCACACCATTCATGCTTGGAGCCTTGGTCGCCATGTATGAGCACAAGATCTTCGTTCAGGGCATCATCTGGGACATCAACAGCTTTGACCAGTGGGGAGTGGAGCTGGGAAAGCAGCTGGCTAAGAAAATAGAGCCTGAGCTTGATGGCAGTGCTCAAGTGACCTCTCACGACGCTTCTACC

N° accesso Ensembl | uomo

ENSG00000105220

N° accesso NCBI

NM_000175

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... GPI(2821) , GPI(2821)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yiran Li et al.
International journal of oncology, 47(3), 1017-1024 (2015-07-24)
Autocrine motility factor (AMF) as a cytokine and a growth factor, is known to regulate tumor cell growth and motility in the progress of various human malignant tumors, however, its role in endometrial cancer (EC) has not been fully studied.
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Dongling Zou et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6725-6732 (2015-04-03)
Chemotherapy is the preferred therapeutic approach for the therapy of advanced ovarian cancer, but 5-year survival rate remains low due to the development of drug resistance. Increasing evidence has documented that microRNAs (miRNAs) act important roles in drug resistance in
Gina Shaw-Hallgren et al.
PloS one, 9(5), e96506-e96506 (2014-05-13)
Nemo-like kinase (NLK), a proline-directed serine/threonine kinase regulated by phosphorylation, can be localized in the cytosol or in the nucleus. Whether the localization of NLK can affect cell survival or cell apoptosis is yet to be disclosed. In the present

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.