Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU072991

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CACACCCTGCATATCATAATGGGGGTAAAGTTAAGTTGAGATAGTTTTCATCCATAACTGAACATCCAAAATCTTGATCAGTTAAGAAATTTCACATAGCCCACTTACATTTACAAACTGAAGAGTAATCAATCTACTCAAAGCATGGGATTATTAGAATCAAACATTTTGAAAGTCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTAACCTTTACATGAGGACTCTATTCTTTAACTCCCATTACCATGTAATGGCAGTTATATTTTGCAGTTCCCACATTAAAGAAGACCTGAGAATGTATCCCCAAAAGCGTGAGCTTAAAATACAAGACTGCCATATTAAATTTTTTGTTGACATTAGTCTCAGTGAAGACTATGAAAATGCTGGCTATAGATGTCTTTTCC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Minghua Yang et al.
Autophagy, 11(2), 214-224 (2015-01-22)
Both apoptosis ("self-killing") and autophagy ("self-eating") are evolutionarily conserved processes, and their crosstalk influences anticancer drug sensitivity and cell death. However, the underlying mechanism remains unclear. Here, we demonstrated that HMGB1 (high mobility group box 1), normally a nuclear protein
Yan Chen et al.
International journal of clinical and experimental pathology, 8(6), 6683-6691 (2015-08-12)
Diabetic nephropathy (DN) is one of the most devastating complications of diabetes, leading the cause of end-stage renal disease (ESRD). And investigations into mechanisms underlying renal inflammation may provide new insight into novel therapeutic targets for patients with DN. However
Zhe Liu et al.
Chinese journal of cancer research = Chung-kuo yen cheng yen chiu, 27(3), 267-278 (2015-07-15)
The purpose of this study was to examine the effect of gemcitabine (GEM) on microRNA-218 (miR-218) expression in human pancreatic cancer cells. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to examine the differences in miR-218 expression between the

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.