Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU072971

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK8

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAAC

N° accesso Ensembl | uomo

ENSG00000107643

N° accesso NCBI

NM_139049

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAPK8(5599) , MAPK8(5599)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wen-Pin Cheng et al.
Journal of the Formosan Medical Association = Taiwan yi zhi, 116(5), 388-397 (2016-09-21)
TRB3 (tribbles 3), an apoptosis-regulated gene, increases during endoplasmic reticulum stress. Hypoxia can induce inflammatory mediators and apoptosis in cardiomyocytes. However, the expression of TRB3 in cardiomyocyte apoptosis under hypoxia is not thoroughly known. We investigated the regulation mechanism of
Lan Xu et al.
Journal of molecular endocrinology (2019-03-27)
Obesity is a worldwide health problem with rising incidence and results in reproductive difficulties. Elevated saturated free fatty acids (FFAs) in obesity can cause insulin resistance (IR) in peripheral tissues. The high intra-follicular saturated FFAs may also account for IR
Lei Zhou et al.
Oncotarget, 8(55), 94009-94019 (2017-12-08)
Isoflurane can provide both neuroprotection and neurotoxicity in various culture models and in rodent developing brains. Emulsified Isoflurane (EI) is an emulsion formulation of isoflurane, while its underlying molecular mechanism of developemental nerve toxicity largely remains unclear. We hypothesized that
Mei-Chuan Chen et al.
Scientific reports, 7, 46149-46149 (2017-04-08)
Patients with ovarian cancer are typically diagnosed at an advanced stage, resulting in poor prognosis since there are currently no effective early-detection screening tests for women at average-risk for ovarian cancer. Here, we investigated the effects of MT-6, a derivative
Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.