Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU053891

Sigma-Aldrich

MISSION® esiRNA

targeting human TET1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ryan J Marina et al.
The EMBO journal, 35(3), 335-355 (2015-12-30)
Intragenic 5-methylcytosine and CTCF mediate opposing effects on pre-mRNA splicing: CTCF promotes inclusion of weak upstream exons through RNA polymerase II pausing, whereas 5-methylcytosine evicts CTCF, leading to exon exclusion. However, the mechanisms governing dynamic DNA methylation at CTCF-binding sites
Piotr T Filipczak et al.
Cancer research, 79(8), 1758-1768 (2019-01-10)
The role of transcriptional regulator ten-eleven translocation methylcytosine dioxygenease 1 (TET1) has not been well characterized in lung cancer. Here we show that TET1 is overexpressed in adenocarcinoma and squamous cell carcinomas. TET1 knockdown reduced cell growth in vitro and
Li Gao et al.
International journal of biological sciences, 16(8), 1324-1334 (2020-03-27)
Myostatin (MSTN) is mostly expressed in skeletal muscle and plays crucial roles in the negative regulation of muscle mass development. The methylation and demethylation of myogenesis-specific genes are major regulatory factors in muscle satellite cell differentiation. The present study was
Bo Hu et al.
Journal of cellular biochemistry, 120(4), 6330-6338 (2018-10-27)
Long noncoding RNAs (lncRNAs) have been reported to take part in intracellular RNA regulatory networks and play important roles in a lot of pathological processes. Currently, lncRNA X-inactive specific transcript (XIST) has been proved to regulate cell migration, proliferation, and
Pankaj Prasad et al.
Stem cells (Dayton, Ohio), 35(6), 1468-1478 (2017-04-05)
Activation of pluripotency regulatory circuit is an important event in solid tumor progression and the hypoxic microenvironment is known to enhance the stemness feature of some cells. The distinct population of cancer stem cells (CSCs)/tumor initiating cells exist in a

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.