Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU050291

Sigma-Aldrich

MISSION® esiRNA

targeting human MLH1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGAGGAAGATGGTCCCAAAGAAGGACTTGCTGAATACATTGTTGAGTTTCTGAAGAAGAAGGCTGAGATGCTTGCAGACTATTTCTCTTTGGAAATTGATGAGGAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAGGTGAATTGGGACGAAGAAAAGGAATGTTTTGAAAGCCTCAGTAAAGAATGCGCTATGTTCTATTCCATCCGGAAGCAGTACATATCTGAGGAGTCGACCCTCTCAGGCCAGCAGAGTGAAGTGCCTGGCTCCATTCCAAACTCCTGGAAGTGGACTGTGGAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCTAAACATTTCACAGAAGATGGAAATATCCTGCAGCTTGCTAACCTGCCTGATC

N° accesso Ensembl | uomo

ENSG00000076242

N° accesso NCBI

NM_000249

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MLH1(4292) , MLH1(4292)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Jinfeng Cui et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 115, 205-211 (2018-03-17)
Sterigmatocystin (ST), being a precursor of aflatoxin, is categorized as Group 2B carcinogen. Our previous studies found that both mismatch repair (MMR) pathways and p53 signaling pathway were involved in ST-induced G2 cell cycle arrest in human esophageal squamous epithelial
Jun-Yu Lu et al.
Oncotarget, 8(24), 38767-38779 (2017-04-14)
Epidemiological data demonstrated that hormone replace treatment has protective effect against colorectal cancer (CRC). Our previous studies showed that this effect may be associated with DNA mismatch repair. This study aims to investigate the mechanism of estrogen induction of MLH1
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.