Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU025821

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1B

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGTTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGGAATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAGAAGGGCAGCTTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAGGTGCCGGCGCAGGAGAGCCAGGATGTCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGGGCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCGGAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACGATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCAAATGCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGCCTCAGAAGACGTCAAACGTAAACAGCTCG

N° accesso Ensembl | uomo

ENSG00000111276

N° accesso NCBI

NM_004064

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CDKN1B(1027) , CDKN1B(1027)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Galit Ankri-Eliahoo et al.
Journal of vascular surgery, 63(5), 1351-1359 (2015-02-24)
The natural response to arterial occlusive disease is enlargement of collaterals; however, the molecular factors that control collateralization are not well understood. The gene p27(Kip1) (p27) affects human response to arterial injury. Previous studies have shown that overexpression of p27
Alessandra Verdina et al.
Journal of translational medicine, 6, 27-27 (2008-05-24)
Nonsteroidal anti-inflammatory drugs (NSAIDs) have been proposed for prevention and treatment of a variety of human cancers. Piroxicam, in particular, has been recently shown to exert significant anti-tumoral activity in combination with cisplatin (CDDP) on mesothelioma cells. However, the mechanisms
Huimin Wang et al.
Oncology research, 25(9), 1431-1440 (2017-01-22)
Nasopharyngeal carcinoma (NPC) is a common malignancy of the head and neck that arises from the nasopharynx epithelium and is highly invasive. Cyclin-dependent kinase inhibitor 3 (CDKN3) belongs to the dual-specificity protein phosphatase family, which plays a key role in
Takayuki Satoh et al.
Scientific reports, 6, 27829-27829 (2016-06-11)
Potent anti-cancer compounds FR901464 and its methyl-ketal derivative spliceostatin A (SSA) inhibit cell cycle progression at G1 and G2/M phases. These compounds bind to the spliceosome and inhibit the splicing reaction. However, the molecular mechanism underlying G1 arrest after SSA
Ela Alcántara-Flores et al.
Molecules (Basel, Switzerland), 20(12), 21125-21137 (2015-12-04)
Argentatin B has been shown to inhibit the growth of colon HCT-15, and prostate PC-3 cancer cells. However, the mechanism by which argentatin B inhibits cell proliferation is still unknown. We aimed to investigate the mechanism by which argentatin B
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.