Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU019961

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhipeng Li et al.
Brain, behavior, and immunity, 79, 228-235 (2019-02-11)
Neuroinflammation is now recognized to be a feature of many neurological disorders. More accumulated evidences suggested chrysin which was contained in honey, propolis, vegetables, fruits and plants can exert biological activities including anti-neuroinflammatory effects. However, the precise molecular mechanisms of
Hongjun Zhao et al.
Rheumatology (Oxford, England), 56(5), 835-843 (2017-02-06)
TNF-α-induced protein 3 ( TNFAIP3 ) is one of the major SLE susceptibility genes involved in the regulation of inflammatory responses through modulation of the nuclear factor-κB (NF-κB) pathway. We aim to assess TNFAIP3 expression in CD4 + T cells
Wenjing Feng et al.
Biochemical and biophysical research communications, 482(4), 1107-1113 (2016-12-05)
The innate immune response provides the first line of defense against viruses and other pathogens by responding to specific microbial molecules. A20 is a cytoplasmic ubiquitin-editing protein that negatively regulates the retinoic acid-inducible gene I (RIG-I)-mediated activation of interferon regulatory
Meng Qin et al.
Frontiers in pharmacology, 8, 953-953 (2018-01-10)
Atherosclerosis (AS) is a chronic inflammatory disease and endothelial cell injury is the initial event. In this study, we investigated the protective effects of ginsenoside F1 (GF1) on AS and the potential molecular mechanisms of ox-LDL induced endothelial injury. ApoE-/-
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.