Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU001761

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRC8A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGACATTGTGTACCGCCTCTACATGCGGCAGACCATCATCAAGGTGATCAAGTTCATCCTCATCATCTGCTACACCGTCTACTACGTGCACAACATCAAGTTCGACGTGGACTGCACCGTGGACATTGAGAGCCTGACGGGCTACCGCACCTACCGCTGTGCCCACCCCCTGGCCACACTCTTCAAGATCCTGGCGTCCTTCTACATCAGCCTAGTCATCTTCTACGGCCTCATCTGCATGTATACACTGTGGTGGATGCTACGGCGCTCCCTCAAGAAGTACTCGTTTGAGTCGATCCGTGAGGAGAGCAGCTACAGCGACATCCCCGACGTCAAGAACGACTTCGCCTTCATGCTGCACCTCATTGACCAATACGACCCGCTCTACTCCAAGCGCTTCGCCGTCTTCCTGTCGGAGGTGAGTGAGAACAAGCTGCGGCAGCTGAACCTCAACAACGAGTGGACGCTGGACAAGCTCCGGCAGCGGCTCACCAAGAACGCGCAGGACAAGCTGGAGCTGCACCTGTTCATGCTCAGTGGCATCCCTGACACTGTGTTTGACCTGGTGGAGCT

N° accesso Ensembl | uomo

ENSG00000136802

N° accesso NCBI

NM_019594

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... LRRC8A(56262) , LRRC8A(56262)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chao Yang et al.
Human cell, 32(1), 41-50 (2018-11-15)
Chloride (Cl-), a primary anion in the extracellular fluid, plays an important role in a variety of physiological and pathological processes, such as cell apoptosis and proliferation. However, the information about Cl- in cancer cell apoptosis and chemoresistance is poorly
Tomoki Konishi et al.
The American journal of pathology, 189(10), 1973-1985 (2019-07-20)
The volume-regulated anion channel is composed of leucine-rich repeat-containing protein A (LRRC8A) and is activated by hypotonic conditions to implement the process of regulatory volume decrease. The role of LRRC8A in regulating genes related to progression of esophageal squamous cell
Atsushi Shiozaki et al.
International journal of oncology, 55(4), 905-914 (2019-08-23)
Although peritoneal lavage with distilled water performed after surgery prevents peritoneal seeding, cancer cells may avoid rupture under mild hypotonicity through regulatory volume decrease (RVD), which is the homeostatic regulation of ion and water transport. The aim of the present study
Unnur Arna Thorsteinsdottir et al.
Phytotherapy research : PTR, 30(1), 97-104 (2015-11-10)
We have tested the effect of protolichesterinic acid (PA) on the activity of the volume-sensitive release pathway for the organic osmolyte taurine (VSOAC) and the expression of the leucine-rich-repeat-channel 8A (LRRC8A) protein, which constitutes an essential VSOAC component. Exposing human
Andrea Milenkovic et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(20), E2630-E2639 (2015-05-06)
In response to cell swelling, volume-regulated anion channels (VRACs) participate in a process known as regulatory volume decrease (RVD). Only recently, first insight into the molecular identity of mammalian VRACs was obtained by the discovery of the leucine-rich repeats containing

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.