Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU000311

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGTGGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATTGACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCACCT

N° accesso Ensembl | uomo

ENSG00000125347

N° accesso NCBI

NM_002198

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... IRF1(3659) , IRF1(3659)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jianhua Liu et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(9), 1840-1849 (2017-06-01)
The inflammasome complex is a driver of organ damage in patients with systemic lupus erythematosus (SLE). Although type I interferons (IFNs) are well established as mediators of SLE pathogenesis, their role in inflammasome activation in SLE has not been assessed.
Yihe Yan et al.
Cancer immunology, immunotherapy : CII, 69(9), 1891-1903 (2020-05-08)
The objective response rate of immune checkpoint blockade (ICB) in hepatocellular carcinoma (HCC) with anti PD-L1/PD-1 therapy is low. Discovering the signaling pathways regulating PD-L1 might help to improve ICB response rates. Here, we investigate transcription factors IRF-1 and IRF-2
Z-D Liu et al.
European review for medical and pharmacological sciences, 24(23), 12334-12341 (2020-12-19)
Cerebral ischemia/reperfusion (CIR) frequently causes serious disabilities and correlates with certain neurological processes. Some studies have shown that microRNAs (miRNAs) exert a neuroprotective effect by modulating the inflammatory process in CIR. However, the biofunction and the mechanism of miR-130b in
Eri Sugiyama et al.
Science immunology, 5(43) (2020-02-02)
The clinical efficacy of anti-PD-1 (programmed cell death-1) monoclonal antibody (mAb) against cancers with oncogenic driver gene mutations, which often harbor a low tumor mutation burden, is variable, suggesting different contributions of each driver mutation to immune responses. Here, we
Meng Du et al.
Theranostics, 9(16), 4688-4703 (2019-08-02)
Deciphering the molecular and cellular processes involved in foam cell formation is critical to understanding the pathogenesis of atherosclerosis. Interferon regulatory factor 1 (IRF1) was first identified as a transcriptional regulator of type-I interferons (IFNs) and IFN inducible genes. Our
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.