Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU124431

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCCCAGCAGTCTCTTACCTTCCCTGATCTTTGCAGGGTGGTCCGTGTAAATAGTATAAATTCTCCAAATTATCCTCTAATTATAAATGTAAGCTTATTTCCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGATGACCTGGGGTTTCAATTGACTTCTGTTCCTTGCTTTTAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTTCCAGGCTGAGGTACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAGAGTCCTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAGTCAGCTTTCCTGCAAGAAGAAATCCTGGTTAAAAAAGTCTTTTGTATTGGGTCAGGAGTTGAATTTGGGGTGGGAGGATGGATGCAACTGAAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Paweena Dana et al.
Cellular oncology (Dordrecht), 43(2), 211-222 (2019-11-16)
Cholangiocarcinoma (CCA) is an aggressive type of cancer. The major obstacles for treatment are its late presentation and the occurrence metastases. Targeting the metastatic process may serve as a treatment option. CD147 is a membrane protein that promotes CCA metastasis.
Qiyan Hu et al.
Oncology letters, 15(6), 10063-10069 (2018-06-22)
Cervical cancer is the second most common type of cancer in females worldwide. It has been demonstrated that microRNAs (miRs) serve important roles in the occurrence and development of various types of cancer, including cervical cancer. The results of the
Ying Z Mazzu et al.
Molecular oncology, 13(9), 1944-1958 (2019-06-22)
Epigenetic silencing of miRNA is a primary mechanism of aberrant miRNA expression in cancer, and hypermethylation of miRNA promoters has been reported to contribute to prostate cancer initiation and progression. Recent data have shown that the miR-193b promoter is hypermethylated
Monica Chang-Panesso et al.
The Journal of clinical investigation, 129(12), 5501-5517 (2019-11-12)
The proximal tubule has a remarkable capacity for repair after acute injury, but the cellular lineage and molecular mechanisms underlying this repair response are incompletely understood. Here, we developed a Kim1-GFPCreERt2 knockin mouse line (Kim1-GCE) in order to perform genetic
Nien-Tsu Hsieh et al.
Journal of cellular physiology, 234(7), 11265-11275 (2018-12-01)
Non-small-cell lung cancer (NSCLC) accounts for the majority of the lung cancer cases that have become a leading cause of cancer deaths worldwide. Overexpression of transcription factor forkhead box M1 (FOXM1) is involved in the inauspicious development of several types

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique