Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU190491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTTAAAGAAAGAAAAGTTGCAAGAATTTAGTGACTGCATGTGTATTTACTACTTAGCTCCTACAACTACTGTTTGGCCATATTTGCTCTCTAGATCCACACATGTATAATATACAGATATGCACATATATTCGAGTATATGTTTGCTTTTATTCTGAACCACTGAGATGTTAAGGTATATATATATATATATATATACCAGCCCTGAATACTTCAGCACTTCCTAAAAATAATAATAATGTCCTTTAGAAACCTTCTGAAACCATTATAAAATCAATAATTTCCAGATAGTGCCTGGTTTTCCAGATTAGCTGTAACTGCCCAGAATTCCATTTAAGTTACAGCCTGATTTTATTTGCAGTTCTTTAATCAGGTTAATAACACTATTTTGAAAAGATGTAGAAGAAATCCTTTCTTCAAACTGGCCAAGTTTATTTCAGGTTTTAATTCAAAATAATGAGTGGCTAAAGAAGTGTGATTTTTCTTCAATCTCTGATTTATATGCCTCTCTCC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ichiro Kawashima et al.
Experimental hematology, 43(7), 524-533 (2015-04-08)
Adenosine monophosphate-activated protein kinase (AMPK) is a sensor for cellular energy status. When the cellular energy level is decreased, AMPK is activated and functions to suppress energy-consuming processes, including protein synthesis. Recently, AMPK has received attention as an attractive molecular
Dong Joo Shin et al.
Journal of cellular biochemistry, 115(10), 1702-1711 (2014-05-14)
Various health effects have been attributed to the ginsenoside metabolite 20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol (GPD); however, its effect on ultraviolet (UV)-induced matrix metalloproteinase (MMP)-1 expression and the mechanism underlying this effect are unknown. We examined the inhibitory effect of GPD on UV-induced MMP-1
Yan Lu et al.
Journal of cardiovascular pharmacology, 64(5), 420-430 (2014-07-01)
: Endocannabinoids are bioactive amides, esters, and ethers of long-chain polyunsaturated fatty acids. Evidence suggests that activation of the endocannabinoid pathway offers cardioprotection against myocardial ischemia, arrhythmias, and endothelial dysfunction of coronary arteries. As cardiac hypertrophy is a convergence point
Julie Sesen et al.
PloS one, 10(4), e0123721-e0123721 (2015-04-14)
High-grade gliomas, glioblastomas (GB), are refractory to conventional treatment combining surgery, chemotherapy, mainly temozolomide, and radiotherapy. This highlights an urgent need to develop novel therapies and increase the efficacy of radio/chemotherapy for these very aggressive and malignant brain tumors. Recently
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica