Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU177661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Insr

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTGCAGATCCTCCTGATGTTCAAGACCAGACCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACAGATTACCTGCTTCTCTTCCGTGTCTATGGTCTGGAAAGTCTGAAAGACCTCTTCCCAAATCTCACAGTCATCCGAGGCTCCCGTCTCTTCTTCAACTATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATGAACATCACCCGGGGCTCTGTCCGCATCGAGAAGAATAATGAGCTCTGCTACCTGGCCACTATCGACTGGTCCCGTATCCTGGATTCTGTGGAGGACAACTACATTGTACTGAACAAAGATGACAACGAGGAATGTGGGGATGTCTGTCCAGGCACCGCCAAGGGCAAGACCAACTGTCCTGCCACTGTCATCAATGGGCAGTTTGTGGAACGGTGCTGGACACACAGTCATTGTCAGAAAGTTTGCCCAACCATCTGTAAGTCACATGGCTGCACAG

Ensembl | Número de adesão de camundongo

ENSMUSG00000005534

nº de adesão NCBI

NM_010568

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... INSR(16337) , Insr(16337)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Ingrit Hamann et al.
Archives of biochemistry and biophysics, 558, 42-50 (2014-06-17)
Copper ions are known to induce insulin-like effects in various cell lines, stimulating the phosphoinositide 3'-kinase (PI3K)/Akt signaling cascade and leading to the phosphorylation of downstream targets, including FoxO transcription factors. The aim of this work was to study the
Isabel Heidegger et al.
Oncotarget, 5(9), 2723-2735 (2014-05-09)
We scrutinized the effect of insulin receptor (INSR) in addition to IGF1R in PCa using in vitro and in vivo models. In-vitro overexpression of IGF1R and INSRA, but not INSRB increased cell proliferation, colony formation, migration, invasion and resistance to

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica