Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU090241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCTGGTAGAAGAGGCCATTAGTGAGGAACTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGATTTCACACTCCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACTTGAAGATGCTGAACCATGCACCCAGTGTCCAGATTCATGATGTCCCGGCAGACCTCCTGACGTATGACAGGACTGACGAGGCCGACGCTGAAGAGAGAGGTCCCGAGGAGAACTACAGCAGGCCAGAAGCACCCAATGAGTTCTATGATGGCGACCATGACAACGACAAGGAAAGTTGATGTGGAGATTTAGAGCAGCATGGATGCTGTGTCCCAAGAGTTCCTTGTCACCTCTGTGGTGGGAAGGAAAGTATGGTTTCCCCAGGTCTGAACTGGGTACCCCCAGGGTGTTTACTAACTCTGGTGAAGGGTTTGGAAACCATATGTGGTTCTAGAATTAACTCCCTTTCCTCAAACTCTCACGGCCTGATGATTGTCCCTCTCAGGGATGAGACATGGACA

Ensembl | Número de adesão de camundongo

ENSMUSG00000024454

nº de adesão NCBI

NM_010411

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... HDAC3(15183) , Hdac3(15183)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
S S Roy et al.
Oncogene, 33(28), 3707-3716 (2013-08-27)
Tumor metastasis is the leading cause of death among breast cancer patients. PELP1 (proline, glutamic acid and leucine rich protein 1) is a nuclear receptor coregulator that is upregulated during breast cancer progression to metastasis and is an independent prognostic
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica