Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU050591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs3

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GACCTCTCTCCTCCAACGTGGCCACCCTCCAGCATCTTTGTCGGAAGACTGTCAACGGCCACCTGGACTCCTATGAGAAAGTGACCCAGCTGCCTGGACCCATTCGGGAGTTCCTGGATCAGTATGATGCTCCACTTTAAGGAGCAAAAGGGTCAGAGGGGGGCCTGGGTCGGTCGGTCGCCTCTCCTCCGAGGCACATGGCACAAGCACAAAAATCCAGCCCCAACGGTCGGTAGCTCCCAGTGAGCCAGGGGCAGATTGGCTTCTTCCTCAGGCCCTCCACTCCCGCAGAGTAGAGCTGGCAGGACCTGGAATTCGTCTGAGGGGAGGGGGAGCTGCCACCTGCTTTCCCCCCTCCCCCAGCTCCAGCTTCTTTCAAGTGGAGCCAGCCGGCCTGGCCTGGTGGGACAATACCTTTGACAAGCGGACTCTCC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shusheng Che et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6805-6811 (2015-04-05)
Malignant glioma is the most common intracranial tumor with poor prognosis. It is well believed that glioma stem cells (GSCs) are responsible for the initiation and progression of glioma. Janus kinase/signal transducer and activator of transcription (Jak/STAT3) pathway plays a
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
E-J Choi et al.
Scandinavian journal of immunology, 82(4), 337-344 (2015-06-16)
Varicella-zoster virus (VZV) is an important viral pathogen that is responsible for causing varicella (chickenpox) and herpes zoster (shingles). VZV has been shown to suppress early anti-viral innate immune responses, but the exact mechanisms are not yet well understood. Here
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica