Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU031691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Casp8

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAAATGAAATCCACGAGATTCTAGAAGGCTACCAAAGCGCAGACCACAAGAACAAAGACTGCTTCATCTGCTGTATCCTATCCCACGGTGACAAGGGTGTCGTCTATGGAACGGATGGGAAGGAGGCCTCCATCTATGACCTGACATCTTACTTCACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTTGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAACCACACTTTAGAAGTGGATTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGACTTTCTGCTGGGAATGGCTACGGTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTTTGCCAGAGCCTGAGGGAAAGATGTCCTCAAGGAGATGACATTCTTAGCATCCTGACTGGCGT

Ensembl | Número de adesão de camundongo

ENSMUSG00000026029

nº de adesão NCBI

NM_009812

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CASP8(12370) , Casp8(12370)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ZZU
KVR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

R Coriat et al.
Cell death & disease, 2, e191-e191 (2011-08-13)
Organotellurides are newly described redox-catalyst molecules with original pro-oxidative properties. We have investigated the in vitro and in vivo antitumoral effects of the organotelluride catalyst LAB027 in a mouse model of colon cancer and determined its profile of toxicity in
Meng Yu et al.
Molecular carcinogenesis, 53(7), 505-513 (2013-01-30)
Activation of telomerase is a key element in oncogenesis and resistance to apoptosis for many cancers. Some histone deacetylase inhibitors (HDACi) or chemotheraputic agents have been reported to downregulate the expression of human telomerase reverse transcriptase (hTERT). However, whether hTERT
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
Kei-Ichi Ishikawa et al.
PloS one, 9(4), e94645-e94645 (2014-04-12)
Mutations in p150glued cause hereditary motor neuropathy with vocal cord paralysis (HMN7B) and Perry syndrome (PS). Here we show that both overexpression of p150glued mutants and knockdown of endogenous p150glued induce apoptosis. Overexpression of a p150glued plasmid containing either a

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica