Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU005531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGGGATTGCACCCATAATCTGGGCTGAATCATGAAAGGGTGTTCCTCTTATCTAATGTACTCCTTTGGGGGACTTTTGTCCCTATGGATTCTTCTGGTGTCTTCCACAAACCAATGCACTGTGAGATACAACGTAGCTGACTGCAGCCATTTGAAGCTAACACACATACCTGATGATCTTCCCTCTAACATAACAGTGTTGAATCTTACTCACAACCAACTCAGAAGATTACCACCTACCAACTTTACAAGATACAGCCAACTTGCTATCTTGGATGCAGGATTTAACTCCATTTCAAAACTGGAGCCAGAACTGTGCCAAATACTCCCTTTGTTGAAAGTATTGAACCTGCAACATAATGAGCTCTCTCAGATTTCTGATCAAACCTTTGTCTTCTGCACGAACCTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000031639

nº de adesão NCBI

NM_126166

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... TLR3(142980) , Tlr3(142980)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
K Mori et al.
Journal of dental research, 94(8), 1149-1157 (2015-06-06)
Damage-associated molecular patterns (DAMPs), endogenous molecules released from injured or dying cells, evoke sterile inflammation that is not induced by microbial pathogens. Periodontal diseases are infectious diseases caused by oral microorganisms; however, in some circumstances, DAMPs might initiate inflammatory responses
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
A I Kajita et al.
The Journal of investigative dermatology, 135(8), 2005-2011 (2015-03-31)
Toll-like receptors (TLRs) recognize specific microbial products in the innate immune response. TLR3, a double-stranded RNA sensor, is thought to have an important role in viral infections, but the regulation of TLR3 expression and its function in keratinocytes are not

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica