Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU224041

Sigma-Aldrich

MISSION® esiRNA

targeting human NRAS

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTTCTTTTAGCCATGTAGAAACTCTAAATTAAGCCAATATTCTCATTTGAGAATGAGGATGTCTCAGCTGAGAAACGTTTTAAATTCTCTTTATTCATAATGTTCTTTGAAGGGTTTAAAACAAGATGTTGATAAATCTAAGCTGATGAGTTTGCTCAAAACAGGAAGTTGAAATTGTTGAGACAGGAATGGAAAATATAATTAATTGATACCTATGAGGATTTGGAGGCTTGGCATTTTAATTTGCAGATAATACCCTGGTAATTCTCATGAAAAATAGACTTGGATAACTTTTGATAAAAGACTAATTCCAAAATGGCCACTTTGTTCCTGTCTTTAATATCTAAATACTTACTGAGGTCCTCCATCTTCTATATTATGAATTTTCATTTATTAAGCAAATGTCATATTACCTTGAAATTCAGAAGAGAAGAAACATATACTGTGTCCAGAGTATAATGAACCTGCAGAGTTGTGCTTCTTACTGCTAATTCTGGGAGCTTTCACAG

Ensembl | Número de adesão de ser humano

ENSG00000213281

nº de adesão NCBI

NM_002524

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NRAS(4893) , NRAS(4893)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sha Liu et al.
Cancer medicine, 6(4), 819-833 (2017-03-24)
We aimed to detect the effects of miR-145-5p on the cell proliferation, apoptosis, migration, and invasion in NRAS-mutant, BRAF-mutant, and wild-type melanoma cells, in order to figure out the potential mechanisms and provide a novel therapeutic target of melanoma. RT-qPCR
Atsuko Ogino et al.
Molecular oncology, 15(1), 27-42 (2020-03-20)
Small-cell lung cancer (SCLC) occurs infrequently in never/former light smokers. We sought to study this rare clinical subset through next-generation sequencing (NGS) and by characterizing a representative patient-derived model. We performed targeted NGS, as well as comprehensive pathological evaluation, in
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Matthew E Welsch et al.
Cell, 168(5), 878-889 (2017-02-25)
Design of small molecules that disrupt protein-protein interactions, including the interaction of RAS proteins and their effectors, may provide chemical probes and therapeutic agents. We describe here the synthesis and testing of potential small-molecule pan-RAS ligands, which were designed to interact
Sushmita Chakraborty et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3852-3860 (2015-03-20)
Leishmania major is a parasite that resides and replicates in macrophages. We previously showed that the parasite enhanced CD40-induced Raf-MEK-ERK signaling but inhibited PI3K-MKK-p38MAPK signaling to proleishmanial effects. As Raf and PI3K have a Ras-binding domain but exert opposite effects

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica