Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU184131

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTTGCAAAAGGGGGAAAGTAGTTTGCTGCCTCTTTAAGACTAGGACTGAGAGAAAGAAGAGGAGAGAGAAAGAAAGGGAGAGAAGTTTGAGCCCCAGGCTTAAGCCTTTCCAAAAAATAATAATAACAATCATCGGCGGCGGCAGGATCGGCCAGAGGAGGAGGGAAGCGCTTTTTTTGATCCTGATTCCAGTTTGCCTCTCTCTTTTTTTCCCCCAAATTATTCTTCGCCTGATTTTCCTCGCGGAGCCCTGCGCTCCCGACACCCCCGCCCGCCTCCCCTCCTCCTCTCCCCCCGCCCGCGGGCCCCCCAAAGTCCCGGCCGGGCCGAGGGTCGGCGGCCGCCGGCGGGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAA

Ensembl | Número de adesão de ser humano

ENSG00000181449

nº de adesão NCBI

NM_003106

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SOX2(6657) , Sox2()

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jiaxuan Chen et al.
Molecular carcinogenesis, 56(10), 2267-2278 (2017-05-26)
Fas signaling promotes colorectal cancer (CRC) metastasis by inducing epithelial-mesenchymal transition (EMT). The acquisition of EMT properties in turn induces stemness but the mechanism by which Fas signaling contributes to it still remains unclear. Hence, the aim of this study
Liang Tang et al.
Pathology oncology research : POR, 24(4), 907-913 (2018-04-06)
Osteosarcoma (OS) was a prevalent malignant bone tumor which threatens people's health worldwide. Wnt/β catenin signaling pathway had been proved significant in various cancers, indicating its possible function in OS as well. Sox2, a crucial member among SOX family could
Tatsuya Ishiguro et al.
Cancer research, 76(1), 150-160 (2015-12-17)
The establishment of cancer stem-like cell (CSC) culture systems may be instrumental in devising strategies to fight refractory cancers. Inhibition of the Rho kinase ROCK has been shown to favorably affect CSC spheroid cultures. In this study, we show how
Keshav Gopal et al.
Oncotarget, 7(3), 3111-3127 (2015-12-20)
We have previously identified a novel intra-tumoral dichotomy in breast cancer based on the differential responsiveness to a Sox2 reporter (SRR2), with cells responsive to SRR2 (RR) being more stem-like than unresponsive cells (RU). Here, we report that RR cells
Nicolas Chassaing et al.
Genome research, 26(4), 474-485 (2016-02-20)
Ocular developmental anomalies (ODA) such as anophthalmia/microphthalmia (AM) or anterior segment dysgenesis (ASD) have an estimated combined prevalence of 3.7 in 10,000 births. Mutations in SOX2 are the most frequent contributors to severe ODA, yet account for a minority of
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica