Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU151861

Sigma-Aldrich

MISSION® esiRNA

targeting human VIM

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei Wu et al.
Virology, 497, 41-52 (2016-07-17)
Influenza A virus exploits the subcellular transport machinery during the early stages of infection. Actin filaments and microtubules facilitate the trafficking of virus-containing endosomes towards the perinuclear region; however, the role of vimentin remains to be determined. In this study
Yue Peng et al.
Life sciences, 249, 117503-117503 (2020-03-07)
To investigate the role and mechanism of insulin-like growth factor 1(IGF-1)-mediated EMT on multiple myeloma (MM) growth and metastasis. The expression data from GEO datasets were utilized to explore the expression levels of IGF-1 and epithelial-mesenchymal transition (EMT) markers in
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Fu Jun Li et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L80-L91 (2017-04-30)
Exposure to cadmium (Cd) has been associated with development of chronic obstructive lung disease (COPD). The mechanisms and signaling pathways whereby Cd causes pathological peribronchiolar fibrosis, airway remodeling, and subsequent airflow obstruction remain unclear. We aimed to evaluate whether low-dose
Brian Koons et al.
ACS nano, 11(12), 12037-12048 (2017-11-17)
Cell migration is studied with the traditional focus on protrusion-driven cell body displacement, while less is known on morphodynamics of individual protrusions themselves, especially in fibrous environments mimicking extracellular matrix. Here, using suspended fibers, we report integrative and multiscale abilities

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica