Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU135581

Sigma-Aldrich

MISSION® esiRNA

targeting human RUNX3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTTCCCTCCTGTTCTCTGGTTATAGCTGGTCCCAGGTCAGCGTGGGAGGCACCTTTGGGTTCCCAGTGCCCAGCACTTTGTAGTCTCATCCCAGATTACTAACCCTTCCTGATCCTGGAGAGGCAGGGATAGTAAATAAATTGCTCTTCCTACCCCATCCCCCATCCCCTGACAAAAAGTGACGGCAGCCGTACTGAGTCTGTAAGGCCCAAAGTGGGTACAGACAGCCTGGGCTGGTAAAAGTAGGTCCTTATTTACAAGGCTGCGTTAAAGTTGTACTAGGCAAACACACTGATGTAGGAAGCACGAGGAAAGGA

Ensembl | Número de adesão de ser humano

ENSG00000020633

nº de adesão NCBI

NM_001031680

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RUNX3(864) , RUNX3(864)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XUT
WNS
JRR
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Bufeng Zhuang et al.
Molecular medicine reports, 19(5), 3933-3940 (2019-03-01)
Dysregulated microRNAs (miRNAs/miRs) directly modulate the biological functions of non‑small cell lung cancer (NSCLC) cells and contribute to the initiation and progression of NSCLC; however, the specific roles and underlying mechanisms of the dysregulated miRNAs in NSCLC require further investigation.
J Justin Milner et al.
Nature, 552(7684), 253-257 (2017-12-07)
Tissue-resident memory CD8
Jikui Sun et al.
Oncotarget, 8(67), 110785-110796 (2018-01-18)
Accumulating data demonstrates that the network dysregulation of microRNA-medicated target genes is involved in glioma. We have previously found miR-19a/b overexpression in glioma cell lines and specimens with various tumour grades. However, there was no report on the function and
Haiping Yang et al.
International journal of molecular medicine, 40(5), 1466-1476 (2017-09-28)
Bronchopulmonary dysplasia (BPD) is a major challenge for premature infants; however, the underlying mechanisms remain unclear. We previously reported that epithelial-mesenchymal transition (EMT) in alveolar type II (AT2) epithelial cells influences the normal alveolar development process. In this study, we wished to examine whether
Lin Shi et al.
Cell stress & chaperones, 25(5), 793-802 (2020-07-19)
Lung toxicity is the main cause of the death from methamphetamine (MA) abuse, but its mechanism has remained unclear. The purpose of our study was to investigate if MA can induce epithelial-to-mesenchymal transition (EMT) and if RUNX3 is involved in
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica