Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU134211

Sigma-Aldrich

MISSION® esiRNA

targeting human HRAS

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCAGGAGACCCTGTAGGAGGACCCCGGGCCGCAGGCCCCTGAGGAGCGATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTG

Ensembl | Número de adesão de ser humano

ENSG00000174775

nº de adesão NCBI

NM_001130442

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HRAS(3265) , HRAS(3265)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based
Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Satoshi Sugita et al.
International journal of oncology, 53(2), 725-736 (2018-06-15)
The active form of the small GTPase RAS binds to downstream effectors to promote cell growth and proliferation. RAS signal enhancement contributes to tumorigenesis, invasion, and metastasis in various different cancers. HRAS proto-oncogene GTPase (HRAS), one of the RAS isoforms
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica