Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU133471

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK7

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTTGTGACCCAGCAGCTATCTAAGTCACAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACC

Ensembl | Número de adesão de ser humano

ENSG00000166484

nº de adesão NCBI

NM_002749

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MAPK7(5598) , MAPK7(5598)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yan Huang et al.
Tumori, 103(5), 483-488 (2016-10-30)
Osteosarcoma (OS) is the most common primary bone tumor and has low cure rates. Our study aimed to evaluate the roles of mitogen-activated protein kinase 7 (MAPK7) in cell proliferation, migration and invasion using the SOSP-M human OS cell line
Byambasuren Vanchin et al.
The Journal of pathology, 247(4), 456-470 (2018-12-20)
Endothelial-mesenchymal transition occurs during intimal hyperplasia and neointima formation via mechanisms that are incompletely understood. Endothelial MAPK7 signaling is a key mechanosensitive factor that protects against endothelial-mesenchymal transition, but its signaling activity is lost in vessel areas that are undergoing
Abrar Ul Haq Khan et al.
Scientific reports, 7(1), 10654-10654 (2017-09-08)
Controlling cholesterol levels is a major challenge in human health, since hypercholesterolemia can lead to serious cardiovascular disease. Drugs that target carbohydrate metabolism can also modify lipid metabolism and hence cholesterol plasma levels. In this sense, dichloroacetate (DCA), a pyruvate
Abrar Ul Haq Khan et al.
Scientific reports, 8(1), 7420-7420 (2018-05-11)
Oxidative phosphorylation (OXPHOS) generates ROS as a byproduct of mitochondrial complex I activity. ROS-detoxifying enzymes are made available through the activation of their antioxidant response elements (ARE) in their gene promoters. NRF2 binds to AREs and induces this anti-oxidant response.
Dae-Hwan Nam et al.
Molecules and cells, 40(7), 457-465 (2017-07-07)
Streptozotocin (STZ)-induced murine models of type 1 diabetes have been used to examine ER stress during pancreatic β-cell apoptosis, as this ER stress plays important roles in the pathogenesis and development of the disease. However, the mechanisms linking type 1
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica