Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU132531

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0A4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCAGGATCCAAGAAGATGCCACTGAGAACATTGAAGGTGATAGCTCCAGCCCTTCTAGCCGTTCTGGCCAGAGGACTTCTGCAGATACCCACGGGGCTCTGGACGACCATGGAGAAGAGTTCAACTTTGGAGACGTCTTTGTCCACCAAGCCATCCACACCATCGAGTACTGCCTGGGCTGCATTTCAAACACAGCCTCCTACCTGCGGCTCTGGGCCCTCAGCCTGGCTCATGCACAACTGTCTGAAGTGCTCTGGACTATGGTGATGAACAGCGGCCTTCAGACGCGAGGCTGGGGAGGAATCGTCGGGGTTTTTATTATTTTTGCCGTATTTGCTGTCCTGACAGTAGCCATCCTTCTGATCATGGAGGGCCTCTCTGCTTTCCTGCACGCCCTGCGACTGCACTGGGTTGAGTTCCAGAACAAGTTCTATGTCGGGGATGGTTACAAGTTTTCTCCATTCTCCTTTAAACACATCCTGGATGGCACAGCCGAGGAGTAGGCTGAGGGCTGCACCTCCCACGGTGGTCACCATGCCAATGAAGGAAGTT

Ensembl | Número de adesão de ser humano

ENSG00000105929

nº de adesão NCBI

NM_020632

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ATP6V0A4(50617) , ATP6V0A4(50617)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shulian Chen et al.
World journal of urology, 35(8), 1247-1254 (2016-12-26)
To investigate the effect of simulated physiological stretch on the expression of extracellular matrix (ECM) proteins and the role of integrin α4/αv, focal adhesion kinase (FAK), extracellular regulated protein kinases 1/2 (ERK1/2) in the stretch-induced ECM protein expression of human
ChangDong Lin et al.
Immunity, 50(1), 137-151 (2019-01-17)
Fever is an evolutionarily conserved response that confers survival benefits during infection. However, the underlying mechanism remains obscure. Here, we report that fever promoted T lymphocyte trafficking through heat shock protein 90 (Hsp90)-induced α4 integrin activation and signaling in T cells.
Yu Yan et al.
Aging, 11(9), 2699-2723 (2019-05-12)
Senescence is a leading cause of age-related cataract (ARC). The current study indicated that the senescence-associated protein, p53, total laminin (LM), LMα4, and transforming growth factor-beta1 (TGF-β1) in the cataractous anterior lens capsules (ALCs) increase with the grades of ARC.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica