Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU132051

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAGACGCCTGCCGCAAGGTTAATGTGGAGCTCAAATATGCCTTATTTTGCACAAAAGACTGCCAAGGACATGACC

Ensembl | Número de adesão de ser humano

ENSG00000146674

nº de adesão NCBI

NM_000598

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IGFBP3(3486) , IGFBP3(3486)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lili Bao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15043-15052 (2016-09-24)
Insulin-like growth factor-binding protein-3 (IGFBP3) is an N-linked glycosylated, phosphorylated protein, which has been reported to regulate cancer progression and metastasis. However, the role of IGFBP3 in tumor metastasis remains under debate. Nasopharyngeal carcinoma (NPC) is a highly metastatic head
Wei Zhou et al.
Oncology reports, 37(2), 1075-1083 (2016-12-22)
MicroRNAs play critical roles in the progression of acute lymphoblastic leukemia (ALL). Previous studies have indicated that miR-196b and miR-1290 play critical roles in T-cell ALL (T-ALL) and B-cell ALL (B-ALL), respectively. Resveratrol, a natural edible polyphenolic phytoalexin, possesses certain
Huiwen Wang et al.
Cancer management and research, 12, 1007-1015 (2020-02-28)
Chemotherapeutic treatment of hepatocellular carcinoma (HCC) has always been plagued by nonspecific and side effects. Plant extracts have potential anticancer capabilities with low cytotoxicity and few side effects, but their detailed mechanisms are still unclear, thus limiting their clinical applications.
Chang-Ling Li et al.
Journal of molecular and cellular cardiology, 139, 98-112 (2020-01-27)
Salvianolic acid B (Sal B) is the representative component of phenolic acids derived from the dried root and rhizome of Salvia miltiorrhiza Bge. (Labiatae), which has been widely used for the treatment of cardiovascular and cerebrovascular diseases. However, the effect
Yan He et al.
Fitoterapia, 124, 200-205 (2017-11-21)
Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica